Description :
From Genome Similarity Track
Location :
contig_91:78802- 80247
Transcript NameFunction/comments
g13071.t1hypothetical protein

Sequence
1445 bases(100 bases per row)
CACACCCTTCTTCATGCCGCGCGGCGTCTTCATCGACATGACAATGTCGCCGGTCCCCACCGCCTGAACCACACCGTCGTCCGCGAGATGCACGTCCACC
GGAGCCATCGTCTTGTAGTTCCTCATGTACGTCTTGGAACTCGTCATGTGCTGCGTCGCACCGAGTCGACCAGCCACATGTCACTCGCGCTTGGCGGTAC
TGCTCGTACGACCAACCGAGAAAAGGCAGTCGCCAGGATCTTCTTCGTCCTGCGCGACGTTCGCACGCTGCGACCGATATCGCTCAGCGTCGTTGTGGAC
CCCGCGAGGGACACTCCGCGATCCAATGTCCTTGTTTGCCGCAGTTGTGGCACGCGCCGGTCTTCTTCACCGGTCGGCCCTTGCGCTTGTTGTTGTTGAC
CATGAACGCTTGACCTTGGCCGTGCGCGGCTCCGTCGACGCCGCCGCCGCCTTGTTCCTTGCGCTTCATGTCCTCATGCAGCAGCCGAGACGTCACGAGT
TCCCACGACAGCGAGTCGGCTCTCGACTCCAACGCCGTGATCAGGAACTGGTACGACTCGCTCAGACTGCCCAGAAGCGTGATCACAAAAGGCTTGGTCG
CTTGATGGCAAAATGCAAAGTGATTGATTTAGGTCCTTAGTTCGCAAACTCCTTTGCTACCTCTAAGCCTACTGGATTCTCTACTGGATACACTCTACTG
GATTCCTTACCGGATACTGAGTTGCTTCAGCCAATCAGCGACTGCCGCGTGGATGCCCATCTTGTACCCACAATCTTGTACCCACGTGTCCCGTAATCCC
CGTAGCGTAAACAGCGTCCCATCATCAGTGTCCCGTCAACACAGGAATGATTGCGGTCCCACTGAGTGAAGGTCATACCGGTATCCTACCGGTATCCCGC
AGCTGCCCGAGGCGCCTTCTTGACAACACTCCCACTCGACTCGACAGCGATTGCACCTTGGATCCCGAGCTTGGTCCGAAGCACATGGAACTGCGTTGCA
GGAATTGCCTTCGTCATCATGTCCGCCAGCATGTCCGTTGTCGATACATACTGCAGCACCACTTGACCGTCTTCCACCTTCTCGCGCACGAAGTGGTAGC
GAATGTCGATGTGCTTGGTGCGCTTGTGGAACTGCGGGTTCTTGGCCAACGCGATGGAGCCTTGGTTGTCCTCGTAGATCTTGACCGCTTCATCGCTTGC
CATCTCGCCGAGCTCGCACAGGAACACCTTGAGCCACACTGCCTCTTGTGTCGCCTCCGATAGCGCCATGTACTCTGCCTTCCGTCGAAGACAGCGCCAC
CGTCCGCTGCTTCTTGCTCCTCCAGCTGATGCATCCGCCGTTCATCATGAACGCGTAGCCGCTTGTGCTCCGTCTTGACTCGATGTCGCCGGCCCAGTCC
GCATCCGAATAGCCGCACATACCAACGCTGGCTTCTCGTGAGAAC