Description :
From Genome Similarity Track
Location :
contig_91:78802- 80246
Transcript NameFunction/comments
g12545.t1hypothetical protein

Sequence
1444 bases(100 bases per row)
CACACCCTTCTTCATGCCGCGCGGCGTCTTCATCGACATGACAATGTCGCCGGTCCCCACCGCCTGAACCACACCGTCGTCCGCGAGATGCACGTCCACC
GGAGCCATCGTCTTGTAGTTCCTCATGTACGTCTTGGAACTCGTCATGTGCTGCGTCGCACCGAGTCGACCAGCCACATGTCACTCGCGCTTGGCGGTAC
TGCTCGTACGACCAACCGAGAAAAGGCAGTCGCCAGGATCTTCTTCGTCCTGCGCGACGTTCGCACGCTGCGACCGATATCGCTCAGCGTCGTTGTGGAC
CCGCGAGGGACACTCCGCGATCCAATGTCCTTGTTTGCCGCAGTTGTGGCACGCGCCGGTCTTCTTCACCGGTCGGCCCTTGCGCTTGTTGTTGTTGACC
ATGAACGCTTGACCTTGGCCGTGCGCGGCTCCGTCGACGCCGCCGCCGCCTTGTTCCTTGCGCTTCATGTCCTCATGCAGCAGCCGAGACGTCACGAGTT
CCCACGACAGCGATCGGCTCTCGACTCCAACGCCGTGATCAGGAACTGGTACGACTCGCTCAGACTGCCCAGAAGCGTGATCACAAAAGGCTTGGTCGCT
TGATGGCAAAATGCAAAGTGATTGATTTAGGTCCTTAGTTCGCAAACTCCTTTGCTACCTCTAAGCCTACTGGATTCTCTACTGGATACACTCTACTGGA
TTCCTTACCGGATACTGAGTTGCTTCAGCCAATCAGCGACTGCCGCGTGGATGCCCATCTTGTACCCACAATCTTGTACCCACGTGTCCCGTAATCCCCG
TAGCGTAAACAGCGTCCCATCATCAGTGTCCCGTCAACACAGGAATGATTGCGGTCCCACTGAGTGAAGGTCATACCGGTATCCTACCGGTATCCCGCAG
CTGCCCGAGGCGCCTTCTTGACAACACTCCCACTCGACTCGACAGCGATTGCACCTTGGATCCCGAGCTTGGTCCGAAGCACATGGAACTGCGTTGCAGG
AATTGCCTTCGTCATCATGTCCGCCAGCATGTCCGTTGTCGATACATACTGCAGCACCACTTGACCGTCTTCCACCTTCTCGCGCACGAAGTGGTAGCGA
ATGTCGATGTGCTTGGTGCGCTTGTGGAACTGCGGGTTCTTGGCCAACGCGATGGAGCCTTGGTTGTCCTCGTAGATCTTGACCGCTTCATCGCTTGCCA
TCTCGCCGAGCTCGCACAGGAACACCTTGAGCCACACTGCCTCTTGTGTCGCCTCCGATAGCGCCATGTACTCTGCCTTCCGTCGAAGACAGCGCCACCG
TCCGCTGCTTCTTGCTCCTCCAGCTGATGCATCCGCCGTTCATCATGAACGCGTAGCCGCTTGTGCTCCGTCTTGACTCGATGTCGCCGGCCCAGTCCGC
ATCCGAATAGCCGCACATACCAACGCTGGCTTCTCGTGAGAACT