Description :
From Genome Similarity Track
Location :
Scaffold_670:788- 8197
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_670-snap-gene-0.6DNA ligase

Sequence
7409 bases(100 bases per row)
GGGTCTCACATTTGGGTATTCGGGCTTCAACCCTGATTTTCGACATGATTTGCAACATAAACATGTCGCATCGCTTTCGATATGTTGACATGTTGCAAAT
CATGTCGAAAATCAGGTGCAAGCCGTTTCCGTACAAGATTGCTTCCATGCGGACGCTGTCCGGAGCGCGTGTCCCCTCTGTTGAGCGGCCCGAGACGACC
ACCAGCAGCAGCCCATGGCGCGGCGGCAGTCGTGGGCGGAGCATGCGCCAGCGGGCTCGCCCGCGCGTCGCGGCGAGCAGCGCAAGCTGCTGATCGAGCT
GGAGCTCGACGACGCCGTGTTCGGTGCCGACGCGGCCGGGCGGAGTCGTCGCGGTCGTAATTCACCCAGCTCGGGATCCCGTCCACTGAGTCTGGTGGAT
GTACCGTATGAAGGATACCCGCATGGTGGACGAGCTGTGGATCGACCGCGGTCGGCGAGCTCGGCGGGTGTTAGGCAGATGGGGTACGCTCACAGAGATG
CAATGGCGGCGACGTCACCTTCAGGATCGGACCAAGCCAGGAAGCTGTCGAGTCCGTTCAAGCTCAAGCAGGAGGTGCTCAGCACGAGGGCGGAGGGTTA
CGCTGAGGACTACTCGCCAGCCGCGCGCCGGAAGACCAAAGGGGGACGAGTAAGCAGACAGTCAAGTCGCACTACCGCCTCCTTCTCGCTGATCCAGGAC
GGCATTCGCCAGAACATCCAGCTTCGGGACGAGACAATCCAGCGGCTCAGGGACGAACTTGTGGTCGGATCAGATAGTAGCCAACGACCTCGAGGGTCTT
CGGCGATGGCAATACCCGCTCGGCTGATCAGTGCGATGAACCGATTGCGGGGGTTGACGCTCGCGGTCGTCGAAATGGTTGTCCATCTGCAGCGACAGTG
TGTACAAGAAAAGAACCTCTTGACTCCGGATGACGCCGACCAAGTGAACGAGGCTCTCGAGTGTGATTTCTTTCCGTACCTGCTTCAGATTTCGTCCACT
GACATGGAGTTCGTGTCGTGTTCGCCGCAATTGCAGCGCTTTTTCGACGCGCAGAGCGTCAGTCTCTCGCGCAACCCGTTCCTGGAGGGATTGACCCTTG
AATCGTCAGAGCTGCTGCTGTGTTCGTGTAATTATGTCTCGTCGTCGTCTGCCTCGGCACTGTTCTCGTCGTCAACCAAGCCGTCAGGGGCGTCAATGTT
CCAACTGCTAATCCACAAGCTCGAGGCTTTCGCCGTGCAAACCGAGCGATTTTTGCCAGGATGGCAGCCACTCCCGTGCAACCGAGTTGCTACTGCACTG
CTCCATTTGATCGAACTCGAGACCCGATGTAATGCCGCTCGAATGATGCCGAGATATCTCCAACCGCCATTGTCTCAAGCTCGCAGTACGCCAGCACAGC
AGAGGCAGGGCTCAAACGTCGGTCCGTCGAATGCTATCAACGATAACAGATCAGCACATCGAAATTGGATGAGCTATGTTGAGGAGATGTACGTTCCCCC
GGAGCCTGTCGCCGTGCATGACCCATGGATCTCAAGCACAAGTCAAGCGTGGGATCCCTATACCGCTGAAGTGCGATCAATGCTCCCGCGAGTACCGTTT
GCTGCACAACAAACCACCGCTGTTGTTGAAGACAATGCTCCTCGATTATCCGATCCGAAGCCAACCACTGCTCCTTCGTTCGAGCCTCCTGAGCTTGCGA
CCGCTGCTGCCAAAGCGAGCAACAGTTCGAGTGTTCGCGCTTCGAAGAAGAAAGGTGGTCGAGAAATAGCATCCACAGTTAGCGAACTCCCGCCTGCCGA
ACCAAAGGTTCAAGTGCATCTCGCATCCATTCAAAGAAGCGACTCCGCGGCCAAGATGAATGTGGTGCAGGAGACCTCAAAGTTGCAGCCTGACCAACGC
TCTTTTGAAGGAGCAAAAGACTCTGTTGATGTCCGCTCAGATCCTGTTCATTCAACTCGGCCGATCCTCGAACCGATCGAGAACAGTCACACGATTCATG
CACAGACGGCAAAAGTCGGGATGGTGGGATCAAGTTCTGCTCTCGAAGAGCTCGAAGAACCGAGAACTAGCTCTTCAAAATCGCCTCTGCAACTTGAAGC
GCTCGCTTTGCAGACGTCGCGAAGCGAACCCCTCGCCTTATCGCCCACACCGCAGCCAGCTGCAACAGATGAAGGCGTCACAGCTGCTTTAGCTCCCCTC
ACCATGGTTCCATCAGACGAGAATGGGTCGGATGAGGAGTACTCGCCGTCTCAAATGATGAAACAGCTCGCATTCGCGATGGATATGCTTCCTCGGTTCG
ATCTTTCCGAGCTGCCACTCAACCTGTCGGAGTTGGATGAGAGTGATCCGTCAGTAGATGAACCTAATGTGATCGCGGGGTTTGATGATAGCTCTTCCCC
TTCTGCTGAACAACACAACCTCGAAGAGCAGGACGAAATTCGTTCCACGGAAAGTCCAGAACCTCACGACACCGACACGGTCAGCATTTACAACTCGGGC
ACGATTGAATCAGCAAATAACATCACATCCGCTTCCGTGGACAACGCACCACCTGATATCGAGGACGTTTCAGTATTTTGTCCCCCGAAGCAGGCTGACC
CCAGTGCTATGTCAAATGTCTCCAACAATGTTAACGACAATTCGGTGCAGCCTCCTGCTTTGAGCAGCACTACTGACGAGAATGGATTTGGACTCGGCAA
GATTTTTGACTTGTGTCGTGACGTCCAAGTTGCAGCTCTAGACTTGCGCCATCGATTCTCAGAGTATGAGGTGGACCTCAACGATCAGACAGAGCTGCCC
ATGACTTTCTCTGGCTTGCGTGATACGCGCAGCAAAACTGTTGGTAATGACGATGCACCGCGCTATTTAGAACGGGAGCTCAAAGTGCTTCGGCGGTATT
TCGCGTCGTGGAGAGAGAACTCGACAGAGCGTAGACGAATCAAACAGAAATTGCAGAGCTCTGCTGCACAGCGGACTATTCACCGGTTTGGAGTGTTTTA
TATCGAGGAACGAAACCGAAGACAGGCGCACAAACGCCACGAGCAGCAGACTGCGTCTGCGCGGGTACTGCAGCGCTCATGGGTGAACCACTCGGACAAA
ATGTCCAAGCTTCGCCTGCAACACGAGTTTGTCCTTCTCCACACGTGCTTCCATCGCATGCGGTTCTTCGCTGCAGTGTCTATCCGGAAGCGACGGCGCG
AAGCTGCGAAAGAGACAATTCTCAGGTGCTGGAGGCGCATGCAAGCCAGACTTCGACGTGTCCGGAAGCAACAGGAGCGATTGCGACAGCAGCGTGAGCG
GAAAGATCAGGCTATTCGCACAATCAAACAATGTCTTCGGGAATGGATTCTAAGGAGAAGACTCGCAGTGGCTCAGCGCCAAACCAGACAAACCATGTTC
AAAGAAAACCTCAAGTGGACCAAGGCGAAGCGGGATCACGAGAAGATCTTGTCACTCGAGAAGAAACGCCGTGACGAACTCTCGTCGAAATTGACCTCGA
ACCTTGCTGAACTGGAGCAAAAGTGGCAGCAGACCGATGCCGAACGGATCAAACTGGCCGCCCACAACGAAAAAGTGTTGAAGCAGCATCAGCGTGCCGT
TGAACGGAAGCAAAGGGAGCTGGCGTGCCAAAAGATCCAAGCGTTTATCAAGGCATGTCATCTGCGACGAAGGCTAGTCGATGCTGAGAAGCGTCACCGC
GACGCCAACCAACAGATCACGGAGCTCGATGCCAAGAATCGGCAGATCAGCGACGAGAGCCGCCGATCGAAGGCGAAGATGCGTCTCCGCCATCGCTTGT
TAGAACGCAGACTGGAAAGCGCCGAGAGAGACAAAACCAGCACGAATGAGCACCACAAGCAGCAGCTGGAAAGCCGCATGGTGAGCGAGAAACTGCTTGA
GAAGGAGATTGCTCGTCGCACGATCAACACATTCGTTGACCGCCAGTTGGCAGTTTCCAAAGCGAAGCAGGAGGCAGAGAGACAAGCTGTCAGCCAAAGT
CTTCTACGTGCTGAGAAAGCCGAAACGGAGATGATGGCTGCTCAAGATTTGTCGGAACGCATACAGCAAGCCAAGTGCAAGGAGCTGCTCCTCGAAGAGC
GTCTTGCCAAGGTCCACAGTGACTCTTTGACGGAGCTTGCTCATCGAGACAAACTGCTGGAGGAAAAGGAAGGCGAGGCACAGCGCGCTGCTGAGCTATT
GCATTTCAATCGAGTGGAAGCGAGCAAAACGCGTTTGAATGCCTGGTTGACGGGGCAAGTCCGCATATCTCGACTGAAAAGAGAAGCCGACGCAGCACTT
GCAGCGGCTACCCAAGAGGTGGAAACTGGAAAGCGCCATCAGCAGGAGATGCGCCGAAACAGCGCTCGAGAAGTTGCGGCGCTCAAGATTGGCTCATTCG
TGGTGAATCAATTCGATTTATCCCGAGCTCGTAAGTCGGACGAGGATGATCGAAGACGCCGTGAGGAGCAATATGCCCGAGAGATGGTGTCGGAACAGCG
TGTGAGAGCATATCTCGTGCAAATCGTGGTTGAAGTGAAGCTCAAGAGTGAGCAAGAGGCCGCTGCTGGCATCGCGACGGCAGTTCGTCGATTGCAGGAG
CTGTCGGTGTCAATTTCGCACCGCAATGAGAAATTGAAGAAGCTCAAGGCGATCACACAAGCCAGGAGAATCCAGGTCTGGTGGCAAAGGGTGAACAGTC
GACGACTGCTTGATCGGGAGCAGCGTCGACGAAGAGAGCAGCGCGTTGAGACAGTGAAGCTTCGCGAATGTGCGAGGCGGATCCAAGCCGGTTGGAGACG
ACACAACATCAGGCGGCAACAACGAGATCGGAAAACGATGAACCGGAAGCTGTCGCATATCGAGACAGTTCTGCGGCGTGAATGTGCACGCCACATTCAG
ACTGAGTGGCGCCGGCACAAGCTACGACGACAGAGAGAAGGAGAAGAGTTGGAGCGACGGATCTTGCGCGTCGAAGGAATCAGGCATCGCGAGTGCGCAC
GGCACATCCAGACCGAGTGGCGGCGATATAATGCCGGACGGCGACGAACAAATGAAGAATTGGTGAGGAAAGTGTCCCGCGTCGAAGCTGTTATGCAGCG
TGAATGCGCGCGTCGGATTCAGACCCAATGGCGAAGGCACTACGCCGAACGGCAACAAGCACTTGAAGAGGAATGGGGTCGGAAGCGAAGTCGAGTTGAG
CAGGTCAAGCAGCGGGAATGTGCACGCCACATCCAAAACGAGTGGCGTAGACATCATAGGGATCAGCAGCGAGCAGCGGAGGAGTTTGATCGAAAAGTTC
GTCGCACCGAGGCGGTGAAGCGCCGGGAATGTGCTCGGCATATTCAGTCAAAATGGCGAACACACCACAGCGAACAGCAGCAAGCGATAAATGAAGAACT
GGATCGAAAATCGCGGCGTGTTGAAGCGGTCAAGCAGCGCGAATGTGCGAGACGCATACAGTCCGAGTGGCGGAGACATCAACATCGAGCAAGTGATGAG
ATGGATCGAAAAATGAGTCGCATTGAAGGGGTAAAGCGGCGAGAATGTGCACGACACATTCAGAAAGAATGGAGGAGGCACCAATATCTGCGAAAACAGC
AGGAACAAGACGAGCTCGACCAAAAAGCCCGGCGAGTTGAAGCAGTAAAGTACCGTGAGAGTGCTCGCCACATCCAAACCCAGTGGCGGAACCATATGGA
GCGGCGTGATCAACAGAGAGAAATGCATGCACGGAGGATGCAGCGAGCACAAGCAATTCAGCAACGCTCGAGAGCGCGTCAGATCCAATGCGGATGGCGG
CAATTCCATTCTAAGCGTCAACGGGAAGCGGAAGCTCTGGAGCGGGAGATTAGTCGGATCAAAACAGTGCAGCAAGACGAGTGTACGAAGCAGATCCAGA
AGGAATGGCGTCGATGGCGCCACCAACAACGAGACCAGGAGGAGAGACGAGCTCTGGTTTCCAATCGGCTAGGCTCCATTCGCCTCAACCAGATGGCCCG
AATCATTCAGCGCTACTGGAAGTGCTGGCAACGCGCCAAACGCGCACTCTACGTGAATGGCCGACTGGAAGCGATCCGCTCGAATTGCTGCGCTCGACGT
ATCCAACGATGCTGGCGTCAGTGGCGGGACACTCGAGTCGCTATGCAGCTCGTCGAACGCATTGCTGCCATTCGGTGCAACTGTTGCGCACGAAGGATTC
AACGCAATTGGCGACGATACCAAATCGCTCAAGCCGCTCGTCGTTTTGACGAACACCTTGCCGACCTCCGCTCTAACGCCTCCGCTCGAATTGTGCAGAG
GTGTTGGATCGACTGGCGCCAACTGAAACTTCAACAAATGGAGGAGGAACGAAAGGCTGCTGCGAGAGAAGCGAGTGCCCGAAAGATCCAAACTCAGTTC
ATCCGATGGTTCATTATGCGAAAACGGAGTGAGCAAACACGAGTTGAAGATGAGGCAGCCGTGCGAATTCAGCGACGATATCGAGGCTGGATAGCAGGAA
AGCAGCGCCGAGCGAACGAGTCCCGCAATCGAGTAGCAGCTCTACGCCACCGGGTTTCTTCGCGTCGCATCGTTCGAGCGTGGAGGCGGTTCAGACATAT
TCAGCAGTTCACCGCCGCGACTCAGATCGGAGCCGTTTGGCGCGGTCGATGCGCTCGACAGGCCTATCAGCTGACAGTTCAGGCGCACCGCGCTCGAGAC
TCGAGGCTAAATGAGATCAAGCTCTCTGTTCTCGCCGTCAAGGTTCAGCGGTGTTGGCAAGAATGGCGCGCTTGTGTCCGGCGCACAAGGAGGGCGGAAG
TGCGAGCCAGAGAATTGGAAATGATTCAGCAGGAGAAGCGTCAAGCGAGACAACGCCAGGCCGTTAAGGAGCAAGCGCCAGTGACGATCACTCAGACACG
CTTTCGATCGCTCAGCAGCAGAGAAGGCAAGAAGAACAAGGAAAAGCTCCGTCAACTCGAACAGGCCAAAGCAGAAGAGGAAGCAGAGCTGAAGCAGGCA
TTTATGCAGCTGCAGCAAGAGAAACGTGAGCGCGATCTTGAGGCTCGCCGCGTGCTGATCGACCCGTTTGTCCGACAGTGGAATCGTCGTGAGCTGCTGC
ACATCCTCACGACCAGCATTTCTACCGTGATGCTGAAAGATGAGGCAGCGAGGATCATTCAACGCTCGTTTCGCCAGCTCCGACGCCGTCTTGAGCTTTG
GTTGCTCGCCAAGCCGTCATCGCAAGCGAACAAGTCCGGTGTCAACCTCGCTTCTTTGGACAATGAGGATGTAACGACTGCGCCTGAGTTTCGCTTCTAC
TTCCAGCACACCAAAGCGTGGATGGAGTGGCTCAATCCGACTGTCTCGTATACCGTTGGCGACGATAAACGCTCGGTCCAGATACTGCGACTGCGATTTG
ATGCCGAAA