Description :
From Genome Similarity Track
Location :
Scaffold_1089:788- 5318
Sequence
4530 bases(100 bases per row)
AGGATCGGCTCAAGGCAATCACTGGAGACGACCCCTTCCAAGAGACGAACAAGATTGTACTATTAGCACTGCACGTTGGAAACGACCACTGGTGTGGTGC
TGTGTTTGATTTTCGTCGCGAGAGTCGAGGAATCACAGTATTCGATCCATTGCAAGTGCCAAAGTAAAAATACTACGATGCATGTGACACGCACCTGAAC
AACCTGCTCGGAGAAATGTGCTCATTTATGTGGATCAAGAGGGAGACAAATTCTCGACAACCCGATATGGCTAGTTGCGGTGTGGCTGTCCTCATGGTTT
CGAGAGTTTTATCTGCGGTATTGCGATGCCTTCCAAACCAAGCCCAGCATTTATGCAGTTCCTAAGGCTTCGTTACATGTTGAATTGTCTTCATTAGTTA
TATTCGTACAGCTGTTAATGAAGATCGCTACAGTCTACACAGTCTACTCATCAAACACATTGTTAGATAGTTGTAAATGCTGTCTGTAAGCAAGACACTG
GAGGGGGAATATGACATTTGAGATTGGTAGTATGCGTCTCGATCTAGACATCGCTCGTCAAGTCGATGGGCGATTTTCATTAAGTCCTTTGTACTTTCAA
GCAACTTATACGTGCGGCTCAGTCACATTCAAGCAACATATTAAAAGTAGGGCGCTAGAACACGGCGCATCCAGTCAGTGCGATCTCGACAAACGTTGAA
ATTTTTGAAATCTATTGTGAATAACTTACCATATCTTACCTCCGTTTTCTGTTGCGGGTACCTGCAGTCCGTCACTCGGTGACTTTGTGAACCTCTAGGT
CCTCAAAGTACCTGAAGGTACGTGCGCCATGTACCTCTAAATCTCACATAAGTACGATCTACTCGGTGTCTCTAACAACGACCATAATATAATATGTACA
TCAGGCCATCTCGAAAGTATTGCATACTGGACCTCGTTGACATAGTTAATATTTgcgaagtgctggaagcacaCCGGATTTCTGGACTGCTATTAATACT
TTCGAATACGAAGGTCCCGAAGACGACGattacgaggaagagtttgctccttAACCCAACAAGTCCAGgttaaggacaaaaataAGGATCAAAAGTTAGC
CCACCCACTCAGCAACTCCTTTAGTCAGTGATGCTATAACGTCGGTATGGACGTGTAGCCCTTCATTGGAGCTGTTGGGTAGTATCACCACTATATCGCC
AAATGCCTTTGCAGAAATGGGAAATATCCTAATGGCATTAATAACATATCGCAAAGTCGTTTTCTGTTTTAAATAGATTCAACCACCGCACTGTATCATA
TATGCTGTAACGGACACTCATGCTAGCGGACTCAGAAGCGCTATACAGACCTGTATGGCAGTTTTTGTCCAAAATCTCAGCGATTTCGAGAACATGAAAT
CCATTTTAATCCTTAAAAGGACAAAATTTGTTGGGGTTAACACATCGAGGAGCATCTCAAGTGGAGGTAGGCTactcattcgggcggatgctgCAGAGTG
TCGGACCGGTCAGTGAACGGCCTACGAGTGACGCAATGCACGCTTCTGGAATAGGAAGCAAGgacacaagcagcagatgtctCTGCTCGGACACCCTGTA
CAATTGTGAATTtcatagttaagcacctcagtATATCAACATTCGCCGATGCTGTAACTCGTTgtgacaattgagaggtgagaaggaatttttacttgag
tATACTGCTGGCAACCTttatattcctgttgaggtggtatgacacttctggggattattaccgaggggattgtctgtacatgtatttaatAAATAACGCT
GACATAGGCCTCCCACGGCAGACAAACTCAAGTCAAACTACGTCTGACTTTCAGTTACTGATTAGTGATTCAAAATGGTTTGTTATCACTATAAGCAGGT
GGTCAACTATGAGAAAGGTTCACTTGGTGAATCATGTCCGAAAAAGTTAAACAAGCCTCGCTTCCGGACCAACTCCTCCCAaaacgcgctctgcattaTT
AGAAGACCGCCCACCGCTCTGGATGGCATACCCATAGCATCGTCGAGAATGGagagcttggccatccaCTGTAGTCGCTCCCTAAGTTCCACAGGGCGGC
AATGAATCACTAAGTCACGTTGTGGccttcgtcttggtcgtgcTTATCGCCCTACCCACACTGGACCGCGCTGCCAACCACcagtgcagcacgagctcaC
CAATTTCCGTGGTGTCAACTACCAATTCAGTATTATAGCCACAAAGAGTCTGTTTGTATCCTATACTATACTGGGATAGGAGTCAACGTAGTGCTGCTAG
CACAGCCCAACAACGTTTAATGGCGTGGTCAGGCTGCACCGATATACCGGTTGTGATACCGGTGGAGTAAGTAGTGCAGCTGTACCAAGAATTTGGCGTC
GACATGTGCAATCTCTGCACCCGATCGTAATACATCGGCTTGGTTCACATCTCTCATCACTTAACTTCCACCGATCCAGACTCCCGGTACCGGTGCTCGA
CGGAATGAGAGCAACATGATGATCGCCGCAGGATTGAGGGGTCGTGTCTTTCCTTGTAGACTAAGTGACATGCGACAGCAAACTGCTGACCGCTGTAGTA
GTGGGATACCTTTCCTTGGAGTATTCTACTCAGAGGAGTAGTGTGGTCGGCCCGTTGGTCGACGAAATGACACCTGACAGCAACATGGTGACCACAACAG
GACTGAAGGGCTGTGCTTTCCCTGGAGTCTGCGCAGAGGAGTGGCAAAGTCAAGGAATATTCTGATTTGGAAATGTTAAAGGTTCTCTGCTCACAACAAA
TAGTGTAAGCCAGGAGGTATACAGGGGCAGCAGGCTGATCCAGAGGGTGcacggcagcaacaagacgAACATAATGCAAGACGCCGACGTCAGCGAACAA
ACGAAAGTGTAGTAGAACGTCAAGCACGATTGGAGAAAGCACGGATCGCCTCCCGCAGACGGCGTGAGCAAAAGAAAAGACAGACTAATCAGCGCCTGGG
GGACCTTAGCGAGCGCGTGTTAGATATTTCGGGTGAAGAAATTAGATTTATGGGAGCAAGCCAGCGATTCACGAGTGATCCGTGCCTTGCTCTCGCATAC
TACTATTGCTGTGGCGTTGACTCGCAAGGAATTTTTTTCGGTGACGAGCAAGTCAATGGAGAAGTGGGGCAGGAAATGTTTGATGATTGCCAAAAACCTG
TTGCCATGGCTGCTTGTCAGAAATTGGCTGAGGAGTCTGAATCGGAAGCTACAGATGTTCGGGCGTGCGCTTCGTGTGGCCGTATTTTACTAGGAAGCGA
AGGTAGATGAACTGTTTTTCGTCGGCTGGACGAGTTGCGAACTACTTTTATGCTAAGCGAAGTTGAAAGGGGCCAGCTTTTTAATAGTGTTCCTGAATCA
ATAGTACGAAAGTATTGTCAAGTGTTTTTTTACGGCGATGGAACATGTTATTTGATACCTGAATTGGTTCGAGACGATAACCGCATCCTCCTCTGTGAAA
GTGCTGTGATGACCCACGCAAAAGCGCTTTCAGTGTAGCGAATGGTCATGACTACGGTCGTACGGATTCTTTACGTGCTGCGTCCACTTGAGCTGCCAGT
TTTGGTCATCTCGAGATTTTGCAATGGCTTCGGATCTACTATCCTCATCGTTTCGACCCCGTCGCGGTTagacgtgctgctcgccacTACGGTAGGGATG
GCCGGCTCGTCGAATATATATGTAACTAGGTAGTGTAGTTGTAATCCGCCTACGTGGCGCGCAATTGTTTTATGCGTGCTTTAGATTAGGTTCTCCCGTT
TTGTTTGTTAGTGTTTCTGCAAGATATATTTTTCTAACACTCGGTGTCGATTAAAATGTCTGTGTGGACACGTTTACATTACCCGATACATACACCACTT
CGCCGGCACCCAGTGCGGGCAATCGGCTGCGACTAGTTTCGCACCTGTAGTATTTGATCTTCCCCCGGGTCAGCCTGCCGGTTTCGGACGTGGGTCTGCA
TCGCACATGCCTGTTGCGTATCCCAAAGTCCCGTTTAGCGTTAAGCTTATTTTACCTGGTCTGACACAtgaaaaataaaaaaattgGCGTGATTGTCGCC
ACATACTACTTCACAAGAAAGTACGATGTATGTGCCCAGTATGTGACTCGATAGTTCCCTCTGATAAAAAGCGCTTTGCTGTTAACCACCCGCTCTTATT
TGGCATTTTGGAGGCTAGGTGACAAGCGGGGCGAGCAGCGAGTGTGAGGCCCGTTCTTGTCTACAGCTAGTACACACAGGCCGTTGTCAATTGCTGTTCT
GTAACACTGAGTATAGCAgggagtgctgctggtggtttGTGACCGTGGTGATGGAGACTTTCATTGGGTGTTGCTTTAACCACGACATATGTTTTGCGTA
GGTCGTGGTGGACAACGACCTGGCCACTGTATTATCCAAAAGGAACAGATCGGTTGTTGGACAGTAATTATGGGTACCTGTACATCTACATCTACATCAA
ACATGGTTATGGCCTTAACAGTATGTGATG