Description :
From Genome Similarity Track
Location :
Scaffold_378:788- 2483
Sequence
1695 bases(100 bases per row)
ACGACCGCGGCCATGGCAGCAAGACTGATGTTAGAAAATCGTTTTCCAACGACTCACCAACACAAGCTAGCAAACCCGCAGTGCACTAAGATGCCGTCGT
ATCCATTCCCGTAGTCCAAGAGCCAGACCAACCCGCTAAAAGTGACGTCAGAGCGAGCTCGCCAGACGGTTTTGCCGACTGACAACTAGGGTAACCGTAA
AGCCCAATCAGGTAGACTTCGTTTGGAAGAAGCgggggggggaggggtaCCTGTTTTTGATGTCGATCAACTGCGAGCAGTACAGGGCACCAAACCGAAA
AACCACGGGTCATGTTGGAAGTACGCAGCTGGGCACCGATTGCACCAGAAGCAATCCATGCGGAAGTCACACACGAGGATGTGCTCATGCCAGCGCTGGA
TCAATCAGAAGAAGGCACCGAAGGTTACGAAGGAGATGATCAGTTGGATCATGAACACTCGGAGGCGGAGTGACCAAAGTTCGAGGAACGATTCCGACAG
ACGAATATGATGCTCGCCTTTTCGATAGATGAGCCGACGATCTTAGCATGACATCAAGGCTACTACCGGGTGCAACGTGAACTAGATACCGGCATCACTC
AAGCGTGTGAGTCGAAGGGGGTGGTTTTTGATCACCACGTCTGCAGTCTGCAGGTGGTCAGGCCGCGTTACAGCTTGGTCGACCGAGGTCTAACGACCGA
GCGCTGTGGAAGATACTACGCGTTGGGTATGTCAAAGTTTATGGCACCAAGGCCCCGGACTTCACAGGCCGCCAGCAACCTGGACCTGGTCGAACTTGAG
TACACCAATGCCAGCTTCATGTCTGCCACCGACCTTTCCGCCGGGTTAAGACATTGGAGGGCGATGGAAGCAATAGTAGTATCGCATGGTACCAGCAAAG
TTCGTCATAACAAGGGGCCAGCAATTTCCGGCAGCAATAATTCCGTGACCAGTCCCGAATAGAGCCGAAGTTCTCATGTCGTGTTTGTGTCGAGTGTACA
GACACCGCTAACAGAGTATATCTGGCGTTCACGGAGAGAAACAACCAAGGGCCCATATCAAAGCGTAGAGGATGCCAGAACAGTCTGGCTCAAGCATATT
CATACCGTCGAATGGTGTGTTGGTCGCCAACAAATGATACGGCCCTCAGCGGCGACGGAGTTGGAGAATCTCAGCCGTAGACTTCACATCTTCGGGGTGA
TATCAGAGTTTATGATCCATCAGATAGAATAGAGGCTAACCGAACTTGGGTACGTGTACCCATTCATGATGGGCGGTGGTGGGGTCCTCTGATTTTGTGC
AATGAACAGAGTGCCTCTCGACTCTATGAGACATAATTGGTTCAATAGCACAGACGAATCTTTCCCGGGAATATCAGACTGGTTGTCAACAGACCAGGTG
AGGACGGAAGACTAGCTGCGGAATGTCATGCCATTTCAGCCGTAAATATTACCACAAAGCCAGATATCAAGTACACAGTGGCCTAGATCGTGGTCACAAC
GGAGACACCTGACTATTCCATGGCCGTGCGAATGGCAGTTGGCATACAATCGCACGGAACACCCACGTCAGTGGTGATGATCCTCTGCGAAGAGAACGCC
GAGAGCTCGCGTGTGTAGGGTATCAACGGTCCTGGCTCAACCGCGAGCGTAATCCAACTGTTCGAACCGATGATGCGCGCAATAATAGCGGATca