Description :
From Genome Similarity Track
Location :
contig_91:78768- 80212
Transcript NameFunction/comments
g10637.t1hypothetical protein

Sequence
1444 bases(100 bases per row)
TCTTCATGCCGCGCGGCGTCTTCATCGACATGACAATGTCGCCGGTCCCCACCGCCTGAACCACACCGTCGTCCGCGAGATGCACGTCCACCGGAGCCAT
CGTCTTGTAGTTCCTCATGTACGTCTTGGAACTCGTCATGTGCTGCGTCGCACCGAGTCGACCAGCCACATGTCACTCGCGCTTGGCGGTACTGCTCGTA
CGACCAACCGAGAAAAGGCAGTCGCCAGGATCTTCTTCGTCCTGCGCGACGTTCGCACGCTGCGACCGATATCGCTCAGCGTCGTTGTGGACCGCGAGGG
ACACTCCGCGATCCAATGTCCTTGTTTGCCGCAGTTGTGGCACGCGCCGGTCTTCTTCACCGGTCGGCCCTTGCGCTTGTTGTTGTTGACCATGAACGCT
TGACCTTGGCCGTGCGCGGCTCCGTCGACGCCGCCGCCGCCTTGTTCCTTGCGCTTCATGTCCTCATGCAGCAGCCGAGACGTCACGAGTTCCCACGACA
GCGAGGTCGGCTCTCGACTCCAACGCCGTGATCAGGAACTGGTACGACTCGCTCAGACTGCCAGAAGCGTGATCACAAAAGGCTTGGTCGCTTGATGGCA
AAATGCAAAGTGATTGATTTAGGTCCTTAGTTCGCAAACTCCTTTGCTACCTCTAAGCCTACTGGATTCTCTACTGGATACACTCTACTGGATTCCTTAC
CGGATACTGAGTTGCTTCAGCCAATCAGCGACTGCCGCGTGGATGCCCACTTGTACCCACAATCTTGTACCCACGTGTCCCGTAATCCCCGTAGCGTAAA
CAGCGTCCCATCATCAGTGTCCGTCAACACAGGAATGATTGCGGTCCCACTGAGTGAAGGTCATACCGGTATCCTACCGGTATCCCGCAGCTGCCCGAGG
CGCCTTCTTGACAACACTCCCACTCGACTCGACAGCGATTGCACCTTGGATCCCGAGCTTGGTCCGAAGCACATGGAACTGCGTTGCAGGAATTGCCTTC
GTCATCATGTCCGCCAGCATGTCCGTTGTCGATACATACTGCAGCACCACTTGACCGTCTTCCACCTTCTCGCGCACGAAGTGGTAGCGAATGTCGATGT
GCTTGGTGCGCTTGTGGAACTGCGGGTTCTTGGCCAACGCGATGGAGCCTTGGTTGTCCTCGTAGATCTTGACCGCTTCATCGCTTGCCATCTCGCCGAG
CTCGCACAGGAACACCTTGAGCCACACTGCCTCTTGTGTCGCCTCCGATAGCGCCATGTACTCTGTTCCGTCGAAGACAGCGCCACCGTCCGCTGCTTCT
TGCTCCTCCAGCTGATGCATCCGCCGTTCATCATGAACGCGTAGCCGCTTGTGCTCCGTCTTGACTCGATGTCGCCGGCCCAGTCCGCATCCGAATAGCC
GCACATACCAACGCTGGCTTCTCGTGAGAACTCGAGTCCATGCG