Description :
From Genome Similarity Track
Location :
Scaffold_419:787630- 790858
Transcript NameFunction/comments
Aphin_H310_01111myosinlike protein putative

Sequence
3228 bases(100 bases per row)
CTTGGCCACTTGTTCCTTGAGCTTGGCGATTTCGGCTGCTTGCGCGTCGACTTTCTTTTGAAGCGACTGAGTCAATTCCTGCTCTTGCTTGAGCTTGACG
AAGTTTTGGCTCAACTGAATTTCCGTGTGCGTCTTGAGCTTTTCCAACTCGGACTTGTAAGCGGCGAGTTGCACCTTGAGTTCGTCGTTCTCCTTCTTGA
ACACCTCGTTCGCATCCTTGAGTGACCCGATCATGTCGCCGGCGTCGGCCATAATCGCTTCGTCCTTGGCTTGCTTCTCTTGCTCCAACATGGCACTGCG
CTTTTGCTCTTCCGCCAACCGATTCTGGAGGGCTTGCAACTGGTACTTCATGTCCGCTTCCAACTTCTTTTCCTGCAGGGCGGCCAAGTACTTGGGGCGT
TGCAAGTGCATGCGAACAAACGACTGGACACGCACAATGATCTTGCGCTTGCGCTGGTAGTTGCGGCGCTTGGCATACCCAGCCAAATGGCGCTGAATAA
TGACCGCACAATGGTTGCGCTTGACTTCCAGCGCCACTTTCCGGCCTTGGATGCCACGAATGCGAGCTTGAGCCAGAATGAGACCTTTGACAAACGTGTT
GTAACGGTGCATGGCAAGGACACAACGAACGAACGACTAGAGTACACACAAGTAGCGTTAGCGCAAGTCGTGCATGACTTAGTGATGCACTCGCGCGCAC
CTGAATTTTGACAACGGCTTGCAATGTCCGCAAGTACTTGAGGCGTTGGCAGAAACCACGCATAACCTTTTGCACAAATCGAGCCTTCTTGTCGAGGAAT
TTCTTTCGGCGATCCTCCAACTCCTCGAGTACCCCCAGTTGAAAGTAGATTTTGGACCACCCCATTTGGTACTGCGTTGGAGACGTGAGTTTCAACTTGT
CCATGAGCTGTTGGCACTTTTCTTTTGACGAGCCAGGGCCAGGCGGGACAAATAAGCGGAACTTAGTCAAGAACTCTTCGTGGGTTTGACGGTTGGGGTA
AGCAGCACGCGAAATACGAATGGCTTCAATCACACCTGTGTCCGATACACGATGGTCACAACTGTTGCTTCAATGATGGGACGGGATCAAATCGCACCTG
CGCAACGCAACTGGGACACCACCATCGCATGTTCCATCGTGTTGGAGCTCTTGATCGAGTTGGGCTTGATGCAGCGGACATATTGCACACTGGTCGCTTG
GATCGAATTCATCAATTCAGTCAAGCTGTCCTTGAATTGTGTGCCGACTGTAGACAAGTTCATCATACCACCGCGGCGCTTATTCGCCGGCTCTTCCTTG
ACTTCTTCAGCCTTTTCTTCAAACAGCTTCTGGATGTACGTGATGTTGGAACTGCGCATCAAGTCGCCCAAGTCGGGCAACAAGTTGTCCTTGTGCTTTT
CCAAAAACCCGATCGCTTCGTACTTGACGGGGGCCGCATAATGCTTGATAATGAACTCGGTTTGCGAAGTGCGGGGGAATTCAATCACGCTCGGCTTGTA
CAGCTCCTTGTTGATCGACATAATGGTCGACATGAAGCCCTTCTCGCTACCTTTGGTCTTTTTCAACTCTTCGTTGAGCAACGAAATAATCCCGATACGG
TCCTCAATCACGTTCAGAACGTCTTGATTGTCAGCATACTCGATGTGTTCCCACTGAATTCCTTCTTCGTCGTACTCGATTTGCACAGTCTTAAACACGT
CCGACGTAAACTTTTGCTGCAGCTTCTCGTTCGCGTAGTTGATGCAAAATTGCTCAAACGAGTTGTGTTTGAAATGCTCAAACCCGAAAATGTCGAGTAC
GCCGATGTGGTGGTCCATGCGCTTGTCGTCAGACAACGAAACGTTGATGAGGTCCACCAACCAGTCGAACACACGAGAGTAGATGGCTTTAGACAGGGCG
TCCACACAGTCCATGGCCGCTTCCTACGCCATTGAGATGAGCCCTGGCTCAACAGCCGCTGAACGATTACCTTCTTCAACGGGACGCTGTACACATCGTT
TCTTGCACGCATGGTGCGCGAGCACAGGGCCTTTTGAAGGGATTCGGGTGTCAATCCCATCAACTGGATTGCATGGGCCGCCGCTTGATCACCTGGCGAA
ATCATCGACTCTTCGTCGTTTGATGGATTTGAAATAATCGAAATGTTCCCCAGGTGTAAAATCCCTGCCAGCGTCTTGTACAAGTCCATTTGCGACGTGT
GATTGAATCCAATGAGCGACAACCGGTCGGCAGTGACTTTGAAATGCTCAAAGTCGGTCTGGCCTTCAATCATGGCGGTGGATTTTTCGCCGATGTACCG
GTAGTTGGCCGCCGGGTCCAAGAACAATTCCGTCGCCGTCTCGCCAGAGTCAATCACCTAAGTCAGCATGCATGACGTAAAACTAGAAGAAGCAACCATA
CCTGGTAAAAAATGTGGTAGTTTCGCTCGGGGTGTTCGTGGCTGATTACACGAGTCTTCTCTAACAGGTACGTCTTACACTTGGCTCCGACCAACGTCCC
CACTCGGTCGAATTGGAGCTGTGTGAACTTGCCGAAGCGAGAACTGTTGTCATTGCGAACGGTCTTGGCATTCCCGAAGTACTCGAGCAATGGACTGACT
TCGATAATTTTTTTGATCGTGCCGTCGTTCATTCCACCGGCAATAGTGGCCAAATGGTTCATGAGAATCTTGGTCGTTTCGGTCTTCCCGGCCCCGGATT
CCCCAGACACCAGGATCGACTGGTTACGCCCAGCAGTCTTCATGTTCTCGTAGGATGCAACCGATGTCGCATACACGTGCGGCGGCAATTCTTCGCGAGG
AAAGTTGAGGTACCGAATGTGTTGATGTTCTGCATATAGATCATGCAATCGCTTGTACGGATTGACGGCGATACAGATGTCGCCTGTGTATGTGTAGGGC
AATTCCTTCAAGAAACGCGTCTTGACGTTGTACAAAATTGCTGCCTCGTGGAGGTAGTTGAGGGTGATCATGTCTTCAATCCCTTCTTCGCCGACGTTTT
CATTTTGGAAAGGAAGGGTATCAACGCTGTCCGTGGATTCGCCTTTGCCGCTCATGAGGGCGCGGGTTCTTTTGTCATCCAAGTTCACCACACGTTCTTC
AGTCGACCCGTCGACGAGCCACACCTTGCACTTGATTTCCTTGGTGCCCGGCGTTTGGCCAATGACTTCGGCAGGCAACCACACGTCCTTTTCATCGGGC
ACGTAGCACTTGGCCCCCGGAACCATTT