Description :
From Genome Similarity Track
Location :
Scaffold_5:787136- 796717
Transcript NameFunction/comments
Phyci_209980Hypothetical protein
Phyci_89787conserved hypothetical protein
Phyci_492901Hypothetical protein
Phyci_209695Hypothetical protein
Phyci_89788Hypothetical protein
Phyci_89789hypothetical protein

Sequence
9581 bases(100 bases per row)
aaagctcaagcagaatcctggcatgaacaaccccatgctcgctgagtggatttgacagcgattttatcgaagtgggagggcgctgtgagcgctagtgagt
atctagcagtggacgaggacgtgcctgcgcacgagccagatgtgatagtggacgaagcagcaggaagtgatgcagtttcgcaggaggaggaggaggagga
ccaggaacccacaattcaacctgccatcgctctgagacactgcatggagctgtctgcatttctgcttcaatgcggagagcagactgatagagaacgaaga
gctttaccgaccgtgaccgctttgtttcggtgaacagcgaattatgcgcgatttctttacgtgcaccacatatttttttttaactgagtccattttatat
gagtcattgttgtagatggccaccaacggggcctcatatagacaggtttgactgtaCCTTTTCGATAGTCGTGCTCTGCTCCAGAGCCTCGTGTGGTGCA
CTTACCGCTGTCTTTCAAGTTTCAAATCAGTGATAAGGCTTGGCGAATTGACAAAAGAAATATAGTATGAAAATCCCGCTCCATGTGCGTTGACAGTGGA
TGTGTAGCACGGAAGCTCATTTGATAAGATTGTCAGTTGTCTTTCAACGTAAACTTGCGTAGGGATTCGCTGAGCGCCGGAGAGTCTTGGGTCTTTGGCC
TGCGGCCGCATTCGTATTGACTGCTGCTATTATTGCcttttggcggatcagatttgaaaaactaccttttacagcaacggggtaggTATTAACTGATACC
GATTTAGAAGCGCATGCTGGTGGTAACCAGCGAAGGTGAGAAAACCTGATTGCGGAGAAAATCGCCGCCAATCGAGCCCTTTCTCCTTCGTAGGACTTTT
GTAGGTAGTGCGAAGGATTCAGTTTACGCTGCTTTAGCAAGGACAAAACCACGCATCGCTGTCCGCATTCATATATGCATCAACTCTCAGAAGAAGAGCA
ACCTCGCCGAACTCTCATGTCATCGGTAGGCATTATGCCTTTCCGACATCCTTTAGCTGGCCATTGCAATTGCTGGTGCTCCAGTGTAGGCACCTAGCCT
CTGTCCTGACATGTTATGCGTTATATAATACAAACCCTAAGATTAAAAGTCCGGCGATTTTTAAAAGGTATAGATCAAAGTCCGCTGAAGCTCCGGCAAA
ACGACAGAAAAGCATACGTAGCATCTACGTTTGCACACAAGTTATTTTAATAAAATAGGGTTGGGCACACAATTAATTCGTGGTTTGATCCGTAAAGAGT
GGTGCATAGTGACCGTTACACACTAGCGAATTCGCTTCAAGTCCGTATGGCGAGTATCCAGTGTGTATCCATGTCGCAGTTATTCCGGACCAGAGCTCCA
TAGCGTTCTGAGTTCTGCTGCGTCCAATCGCGGACAGCGAACAGACGGCCCGCAGAATAGAATCGCCGTCGTAACGGGCTCCGATCTCATGACGCTGCTC
AAGGACGCGTCGCCGGCGTCTTCAGACTGCAGCTCCGCCACTTCGTCCTCGGACAGCAACTCGATGGTCGTGGCGGCGGGCTGCAAGCGCGGCGTGATGC
CCGAGCCCGCTGCGATGGCGCGCCTCTCGCCCGCGACAGAAGTGGCGATCCGCCTGCTGCCTGGCAACGACGTACGTTTCCCTCGGGGGCCCAATTGACT
CTGCATACTTGGTCTAATAGCGTTGGGTGAATTGACGTTGTGTTGACAGCGCTGCGTGGACTGCAAGGCGGTCTGTCCGCAGTGGGCGGGCGTCTCGTTC
GGCGTGCTGCTGTGTCTGACGTGCGCCGGGAAGCACCGCTCGCTGGGCGTACAGACTAGCTTCGTCAAGTCGCTGGCCATGGATGCGTGGTCCGCAAGCG
AGGTCCGCGCGCTGGAGCTGGGCGGCAACGCTAAGTGGGTCGCGGTGTGCGCTGGAACGGGGATATCCGATCTTCTCCTGGTGGAAAAGTACGCGACCGG
CGTGGCCAAAGCGTACAAGAGCCGAGTGCAGCTGGCTGCCGCGAAGGACCCGTCGGTAGAGTGTGCGTTTAGTGCGACGTCGTTTCTGTCGATGCTGGCT
GGCATTGCATCCCCGACAGTTGAAGAGTACCCGGCTCAAAGTGTCAAGGAGGACCCTGCTTCGTCCCCGATCGTGGTAGCGAAGTCACCGAGTCGCGATG
AAGCTGCGTACGGAACAACCGTCAAGTGCACGACGTGCTGCTCGAGTGTGCCGCTGGATCAGTTGAATTCGCATTCGAAGGCTTGTACCGTCACGGTTTC
GGTACGTCCTGATTGTGTTTGCGCTACACGGGGGATTGCTAGGGTAGAAACTAATGCTGTTGTACATGTCTTGTGGTAACAGCAATGCGCTGTGGAATGG
AGGAAATACGAGCGCAAGATTGGAACTCCTGGTGAACCGTTAGGCTTCACTTTGGCGAAGGCGAAGAGCGGATATGCGGAGGTGTCGCGGGTTCTTCCGG
GTGGTGCCGCTGAACGAGCCAACGTGATCGTTGGCAGCTTACTTATCGGCCTGGACAACGTGAAGAACCTGAAATTCGACGAAATCGTGGATATGCTTCG
AACACAGCCGCGGCCGGTGTTGTTTCATTTCGTCTTTCGCTCTCAGATGGCGCCAGAGGGTCCAAAGACGGTCATCGCGTCGGTCCCCGAGCCTCGGACC
GTCGAGATAAACGTGACGCTACACGATAAGGAGGAACTCGGTTGTTCATTGTCCGCAAACGAATTCTATTGTGTCGTGCGGAGCGTTGACCAATACTGCA
TCGCAAGGAGACACGGCATTTTGGTTGGCTCGCGAGTTGTGGCCGTCAATGGACGCAAGTACTTGAAGCCGAAGGAGTTAATCCGAGAAATCTGTACAGC
CCAGCGTCCGATCAAGATAACAATGCATCGTGTGGAGGGGCTAATGAGAGGTTGGAGTAGCTAAGAAGAGCTTATCGAGTCTGGCTGGTCTTGATGGGGC
AGGTGCGCGAAACTGGTAACAGCCATATACAGTACCATATTGGTAGAGCACAAAGCGTAGCTGCTATCTGAGGCAGAGCGTTCAGATTCCTCACATCTTC
GAAAGTGTTTCGAAGTGACTCAGGAATCTCCTGTTAGATAATCTAGAGCATGTAAATGAGAGAGAAGTTGATTCACAGTATTTACGTTGGCGTGAAGTCA
CAACCAGTTCGCTGTACGATCTACACATCCGGCACCAGTCGAGCATCCTGGTGCCTGTTCTTATAGTGGGTAACCACATAGTCCGCTGGTGCTTCCTTCT
CCCTTGCGGTCGAACGGAGACCAGCAAGCATCGGGTGATACATCACTTGCTTGAGTGTGGGGCGTCTTAACGGATCAAAGTCTACTAGCTTCATCAGCAG
GTCCATCGCGCCCGGGATTCTGTTTAATCCTTCACGGCATCGACGAATATTGGCATTGGACCCGCTTGCCAGTGAGAACAACGACTTGTCACTTGCGTAT
TGATCCGTCGTCGTTTTGGCGTGCTGTTGGGTCCTACTTGTCCCTGCTGTTCGTCTGGACCGTCGCTGGGGGTGGTTAAGGGCCGGGTCTTCTGGTCGTA
AATGCTTTAGCAGGACTTGCCACACCCTGTCAATCCCTTTGCTTTCGCTTGGGTTTTGCTGTGGTAGGCCAAAGAGTACAATAAACCTGTACAGTGTATG
GCATAGCGTGTTTTCATCGTCGCCGCGCGCCACACTTTTGATCACAGAAAATTCCGAATTCTTGCGCGGACTCTAGCGTCGTGCCGAAAAAAATATAGGC
AAAGTTGTTAGAAAGCGCATACATCTACGAGTGAATCATTTGTGAACACACTAACCATCCAGATGAACTTCAGGTCCTTCAGGAGTTCAGCAGGGCATTG
GACATCTTCCAAAATCTCTTCATATGGAGCACTATTCGCAACAGTGGCAAGTCAGTAAACGCACAACACATCCAGTGCTAAACAAGTTGGCCTACCTTCC
AGTAAACAAATGCAATAGGCAGAGTCCTAATGAAAATGTGTCGGCCGCGTAAGATTGCTCAGCGGCATCTCCTTCCAACAGGAACTCGATAGGCGAGTTT
TCCAGAGTAGCGAACTGGTCAATCGTGACGGGCTTCCCCAAATTCTCCGGGTTTGAGTCAGCCGCGCCGTAGTCTGCCAATTTGACCCAATACGAAAAGG
ACGCGGGCATCTTTAGAACGAAACAGGAGTCTTCCAGCAGATAATGCAAAACAACATCAGCCCCAGGCCCCTTGCTGAGATTGGCACGACCAATGTCCCT
CAAAAAGAAATTGAGAAGCTGCACGAACAGGAGAGAACAGAAGTACACATTAACAGTCAATCCAAAAGCAGTATCTTGCTTGTAACATACCTTGACATCA
CCATGCCGAAGTTTAAATCTTTCTCGAGCACAAAACAAGCCGAAAACCATTTGGAAGAAAAATGGCACAGCAACTGATTCCAGAGGAAGAATCTTGCCCT
TCTGAAGACCAATAAAATCTTCGAGATCGCCACCATCACAAAATTCCATCCGGATGTACTGGAATAAACTATCACTTCTCATGCTTGGAGACGGTGACGA
GTTGTCCTGGTTATTCGAGGTTGCTGAATAGGAACTTGCATCCGCCAACAACTCGACCGGCTTGCGATGCGTTTGACTACCCCAACGCTCTTGTCGGGGT
TGCTCCTTTGCGAGAAAAACGTCGTAAATTCTGAGGAAGTTCGGGCAAATACCATGCGCTGTTGCGTCCGACAGCAACACCGAGTGTGCAACTTCTTGCC
GAATAACACCCTACAGTGACAAAACTCCAAAAAGTGAGATCGGATGGTCTACTCCTTCACCTTCTGAATAGAGAACTTGCGCGGATACCTGATTGCCAGT
GTTTTCGATTGCACTGATATTCATTACACTAACGGCCTCCAAACGCTTTTTTTCGGATGAAAATACTTTAAACACCTCCTTGTAGGCACCATTCGCGAGA
TAATGACCACGCGGGTGCCGATTGTAAACCTGATGCATGGAATAGAAATTGGCTTTCCTGTACGTAAAAAGAGTCAAGTGTCCCCTTAGGTCTTCCATAG
TCGACAGGCAATATCGCAGCTCGGAACGTACTTTGAATAGTCCGCGATCGCCCATGCGTATGACCTGTTCGCACCAACAAGCGCCACTCGAATTAGATAT
CAATTGCGGCAACAAGCAGCAGAAAAACTTACATGATAGCTATCTTCTCCCACACGGTTGAGACCTTACGGAGCACTTCCTTCATGGTCGTCACATCTAT
CAGCCCTGAATGCAGAACAAGGTACAGCACATTTTCTTCCAGCATAATTGTCTTCTTTGGAGAACTGCTGTCGCCAAGCGAGATATGCCGCTTGACCGGA
GTTAGCGACATCTTGCTCATCTCGCGATCCCACTTCCAGTCGTCTTCCACAGGAGGGAGGAAAGAAGACGACGACGGGGCCATAGCGATAGAAGAAAGTC
GTCGCCCCGATATCCTCCCTAGTTTCGACAGCCGTCTTGCCAAACGACGATCCCTTCGAACTGAGGGCTGAGCGAGAACGTCTTCCATCGCATCAGCGAT
CGCCATGTGCTGCGTTGACGACAGCAGTCGGTGATTCTCCGAGTACGACACGACCTCCAACGTCTGCGACTCCAACTTCTGAAAGTATTTTTTCAACCGG
ATCATGGCAGGATCCGTCGAATAGTCTCCAGCCTGCTCTTTCTCATCCTCATCATCTCCACTTGCCGCCTCACCACCATCTTCACCCTCCACCCCTATTT
CTTTCTCGTTCTCACCTCCTCTTCAAACACAATACCACACATATACACGCATTAGCGTGCATACACCCTCGCAGCTCTGCCCTTCCATCCACGTACTCTG
CAATCGATGGCACTCGTTGCTTCAGTTCACTCAGAATCACATCCGCCTTCAGACTAGCAACTCGCAGGGCGCTCCGACCCAACGACGCGCCAGACGAGAA
ACCCAGTGCTTGGATCCACAGCTGCAGTTCGTCCCGCTTCCGCTTCGTCTTCCAGCTGGCCGCCGGTAGCTTCACGATGTATCCCTGGCCCCCGCCGAAC
TCCGCCTCGAACTTGGCCTGCTGCACTGCGCTCAGCTGCTCCGCCAGGTACTCGATGAACTCCTGTGGCGCACCGTGTACCAGCTCCTTGGTACTCTTCC
GCTCCACCGCAGCGCTGGGCTTGGGCTTCTTGGTGGGCGGGAGCAGCGCCTTCTTGGCCCTACTGGCCTTCCTCTTGGACCCCGCCGCCCGGGACTTCGC
GGGCTTCGACGCAGGAGGGGACTGAGACATCTCCGGGAAGGTGGAGGCCGCACCAGCGTCTTCCTCGGTCTCGTCCGCCGACGACAGCGGCGAGCTGCAG
ATACCGCGCCGCGCCATGATAGACAGATTCAAACTGGAGCCCGCGAAATGCGCACAAGCGTCAGAGTGATGGTCGCCCAAGGCAACTGTTTTTTCGGCCA
ATGGTCGCGCGGAGAATGACTTCAACATGCGGATTGGCTGAAAGCCCATCTTGGGTGCGCGTGGCTGGGCCCATAGTGGAGCGCCGAGAATCGCACCAAG
ATGCACGTGAAGCCGAGCTTCTTCCGCGCGCGGCAGGCACACTTGTCTAAGGACGCGCAAACCAAGTGGACGTCGGACCACTCTGGCGCGGGGGGCAAGT
CGTCCATGGGCGTGCTGCTGGACTGGCTGGTGACGCAGGGTAACTACGACCGCTGGCGGAGCTGCAGTGAGGCCGGCGAGAGCCTCCGGCCGCTGGCCGG
CGAGATCGTGCAACGGCTGCACGCCGAGGGCCTGGTTCACCGCACGGCCAACCAGGTGCAGGCCAAGATGGCGGAACTCGAGCTGGCGTACCGGGAGGCG
GCCGAGCGGCTGGCCAGCACCAAGCGCGAGCTCCAGGCGGCCGAAGGGACGCCGGCGGAGCGCAACTTGCGCCGCGTGCTAGAGCGCCACTGCCGCTACT
TCGCCTTGCTGCAGCCTATTATGAAGGACATGGACAGGGAGGTGGACTCGCCGCCTTCCAAGAGGCCGAGGCTGAGTACGAAGAGAAAGACGGCGAAGGT
AGTGCAGCAGTCTGTAGTGGCTGCCAAAGTTCCTGATCCAATTCCAGCTCCAGCTCCTGCTCCTGCTCCTGCTCCTGCTCGAGCTGCGAGTCCCTCGCCT
GCCAGGTTGCGGTCACGCTCGCCGTCACCGGCGAAGAAGCGGTCCCACTACCAATTGAGAGAGCGGCGAGGGATGGAGTCGCTGTCGGAGGGCATGGTCT
GGGACTTTGACAACGAGTCGATTGGTGGCATGCGAGGTCCGTTCACCCCTCCGACGCCGCCAACCACGCGATCAGTGAGGAAGAGCAAGAGTTTGGCGAT
GGAATCCATTTCAGTTATGCAGCTGGAGGAGGAGGAGGAAGAGCGAGGGCATCCACGGCGCCGACGGGACCTACCGGCCGATCCCGTGAAGAAGCGGCAG
GCGCTGAGGTCGATTGATGAAATTGACCTGGAAAAAGCCCGCGTGGAGCTCACATTGCGCCAGCTGGAGCTGCAAATGGCCCGCGACAAAGCGCTCGTCA
CTCGCGCGAAAGCCCGGGCACAATTGCTCGACCAAGGCGTATCGCGGCGAGAGGTCGACCGGCTCATGCCGCTCGACATCTGAACGCATGTCCGACTCGT
TCTGCGGCGAAGCACCGCATCGAACAGATCCCTTTGGTTTGCTGCCAGAAATTCTTGCTGGCGTGTTACTACCTGTAGTATGTGGCTGAATCCTGGAACC
CGAACGTTGTGGTGATGAAGTGTCGGCATTTATTGCACTTAAATATCGAGTCAATTCTTCCATGACTCTTCTATAGGCTACATGCTGCGGCCCGGGTGGC
ATGCCAAGGTCCATTGTGTGGACAGCGGCGCCGAGCCCGGTCTTCTAGGTCCACCCTAGCATGAGGTGGGAGAGGGTGATTGTTCAGCGCGGAACGAACT
GAGCGGTGCCGAGTTGTGCAGTGCCTGCACTAGCACGCGATGTCGTCGTCCGTTGCCTGGCGTACTACGCGAGTAGTCTGGTTGTCCTGAGCAGGTTGGG
TCGCGACGCGCTGCATCGCTTAGGCCTGGACCGGGAAGGTGCGCTGCGAGAGCAGCACAACGAGCTCGAGCTTGGAGATCGGGGACACGTCGATGGGGCT
GCGGTCCACGGCGGGGTCGGCGCTACCGATGATCTCGGGCGCCATGGCGAACGACACGCCCTTGCGCGCGCGGCGCGGGGGCTTGGCCATCATGTCCTTG
CTGACCCAGGCGCAGTCGCGCGGGCGCTCCTGCTTGGCGTACAGCGCGCGCAGGCATTCCTGGCGGTAGTACTCGGTGAGGCAGGCCTCCATTTCCGACG
CGCAACGCTTGCCGAGCATGACTGTCTGGTGCTTCGGGGGTGGGGGCGGTAAAAGTGCAAATGCGAGGTTGCTGGCAAAAAGCACACTGGGCTGTATTTC
GGTCGCTGCTCGCCAGCGCCCGTAGCGACTTGCCAGCAGCAGGTCTCGTCGCTTGTGGCCTGTACGGAGACTTCGCCTTTCCAGCCGCTCGCGCCGAACG
CGCCTGGGCGCATTACATATGTCGATAACCGTTGAGGCGGCCGTCTTTCCGGCACGCGTGACTCGCGCCCAGTATGGCGGGGTTTGAACTGGAGTTTAAC
GCCCGGAGTGGGCCTGCTGCTTCAGAACCAGCATGCACTTTTGCGGGGCGCGCAGGCGAGGCGCGGCAGGTGGGTGCTCTTGGTCATACGTAGCTGCCCA
CGAGTTGGAGGCCGCATGTTTGTAATAAGACGTTGTCGCCTGGGCGAGGACGGAATGGGCGCGCACGGACACCCGCTGCCCAGGAACCGAGGCCGAGAAT
CCACTCGCCGAGGACGAAAGCCAGAAGGCGGCGGCGCCCTGAGCGGCACGACCGCCAACGTCCGCACGCACTGCGCCATTGGAACGCCTCGGCCGCGTTC
CGCTGATTCTCTCGGCGTTCGGTCCCTATTCGCCTTCTTTTTTCGAGCGCAGCGCTATGGTCGACTAGCCCGCGCCCAGCTGGTCCCAAGGCGAAGCTCG
GGCTCGAAGGCGGAGCTGCCACGTAACGGATCCGCGCCGGCCGTTGTCGGGCAAGGTTATTCGGCGCAGTGTGTCGGTGCAGTTTCCTCGCCAAGCCTGC
GAGCGCCGCGCCAACTGCTTCTGCAGCGGCAGCAGAGACTGGGAGGTGGCTCGGCAAACATTGAGCGAGGCCCCGCGCCCAGATCTCCTGCGGCCTTTGA
CTTGAGCCTTGACTCGAGGCAAGTCATGATACGACCACGGTTCCTCAATGATAGGAGCATGGCTACGCCGCGGCAGCTCTTCACTGCGATCCTGGTGTCA
TTTCGCACAGCAAAAACCGCGAGGTTATCCAATTCGTGGACGACAGAGGGGCAACGAAACGTGTTGGGCAGTTCCGTCTCGAAGCTCTCGGCGCTTTGCC
GTTGGGCTATTTGTCTCTCAAAAAATCGCAGGAAACTCCCACCATCCTCAGCTTTGCTCCGCGTAAAGGTCTCAGCTCGGT