Description :
From Genome Similarity Track
Location :
Scaffold_212:78706- 81778
Sequence
3072 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTTGAGTGCGTA
AGAGGTCTGGAGCAGACGCAGTAGCCACGCCAGAAGCGCGAGAAGCCGCGAAGGACCGTTGTTAGCGCCGCGAGATAGCAAGGAGAAAGGAGCAAAATGG
TCATACGGGGGCTCGAACCCCTGGACCGCAGCGTTATTAGCACTGTGCTCTACCGACTGAGCTATCCCGCCCGGCAATTCGCCACCCACCACACACAGAA
ACCAAAATCCCGCCCTCATCACAAAGCGACTGGATACACACGCACGCACGCTGCACCACGCGCTTCTGCGCGCCTTCGCGCTGCTCTACCACCTCGGCCT
CGCCAGTCCGCCCACTTCCCACCCAACTCCAACCGACCCAACGTCGAACATCCCACAGAGCTTGTCGCCGTACAAACTAGCCCACGGGGTGGCACACACA
CACACAGGCTCGGACACCTCATCTTTGGGCTCCGGGAGATCTTGCAGCCAGGACCGATACTCGAGTCCGTTGGTCGGAGTCGAGCCGCCGAGGCAGTTCC
GAGTCGGTGTTTGCCACGCCCGTTGTAGGTGACATGGAGGTTCGGTTGAGTGCGTAAGAGGTCTGGAGCAGACGCAATAACACGCCAGAAGCGTGAGAAG
CCGCGAAGGGCCGCTGTTAGCGCCGCGTGATAAGCAAGAGAAAGGAGCAAAATAGTCATACAGGGGCTCGAACCCTGGACCGCAGCGTTATTAGCACTGT
GCTCTACCGACTGAGCTATACGACCGCCAATCGCACACAACACACACAGAAAACAAAATACCGCCCTCATCACAAAACGACTGGATACACACGCACGCAC
GCTGCACCACGCGCTTCTGCGCGCCTTCGCGCTGCTCTACCACCTCGGCCTCGCCAGTCCGCCCACTTCCCACCCAACTCCAACCGACCCAACGTCGAAC
ATCCCACAGAGCTTGTCGCCGTACAAACTAGCCCACGGGGTGGCACACACACACACAGGCTCGGACACCTCATCTTGGCGCTCCGGGAGATCTTGCAGCC
AGGACAGATACTCGAGTCCGTTGGTCGGAGTCGAGCCGCCGAGGCAGCTCCGAGTCGGTGTTTGCCACGCCCGTTGTAGGTGACATGAAGGTTCGGTTGA
GTGCGTAAGAGGTCTGGAGCAGACGCAGTAGCACGCCAGAAGCGCGAGAAGCCGCGAAGGACCGTTGTTAGCGCCGCGATAAAGCAAGAGAAAGGAGCAA
AATGGTCATACAGGGGCTCGAACCCTGGACCGCAGCGTTATTAGCACTGTGCTCTACCGACTGAGCTATACGACCGCCAATCGCACACAACACACACAGA
AAACAAAATACCGCCCTCATCACAAAACGACTGGATACACACGCACGCACGCTGCACCACGCGCTTCTGCGCGCCTTCGCGCTGCTCTACCACCTCGGCC
TCGCCAGTCCGCCCACTTCCCACCCAACTCCAACCGACCCAACGTCGAACATCCCACAGAGCTTGTCGCCGTACAAACTAGCCCACGGGGTGGCACACAC
ACACACAGGCTCGGACACCTCATCTTGGCGCTCCGGGAGATCTTGCAGCCAGGACCGATACTCGAGTCCGTTGGTCGGAGTCGAGCCGCCGAGGCAGTTC
CGAGTCGGTGTTTGCCACGCCCGTTGTAGGTGACATGGAGGTTCGGTTGAGTGCGTAAGAGGTCTGGAGCAGACGCAGTAGCACGCCAGAAGCGCGAGAA
GCCGCGAAGGACCGTTGTTAGCGCCGCGATAAAGCAAGAGAAAGGAGCAAAATGGTCATACAGGGCCTCGAGCCCTGGACCGCAGCGTTATTAGCACTGT
GCTCTACCGACTGAGCTATACGACCGCCAATCGCACACAACACACACAGAAAACAAAATACCGCCCTCATCACAAAACGACTGGATACACACGCACGCAC
GCTGCACCACGCGCTTCTGCGCGCCTTCGCGCTGCTCTACCACCTCGGCCTCGCCAGTCCGCCCACTTCCCACCCAACTCCAACCGACCCAACGTCGAAC
ATCCCACAGAGCTTGTCGCCGTACAAACTAGCCCACGGGGTGGCACACACACACAGGCTCGGACACCTCATCTTGGCGCTCCGGGAGATCTTGCAGCCAG
GACCGATACTCGAGTCCGTTGGTCGGAGTCGAGCCGCCGAGGCAGTTCCGAGTCGGTGTTTGCCACGCCCGTTGTAGGTGACATGGAGGTTCGGTTGAGT
GCGTAAGAGGTCTGGAGCAGACGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN