Description :
From Genome Similarity Track
Location :
Scaffold_640:7870- 11895
Sequence
4025 bases(100 bases per row)
AGCACATCCTGATTGCTAGTGGTAACGCACTGCCGCCGCCAGCCTACGGAGCGGTATGCGATATCGACACACAGGGGCACGCCCCAATTAAACAGCGTGC
CCGACGCGTGCCGCTGCGATTTCTCGGCAAGCTGTACGAGCTGCTGCGCGCTTTATTGCGTGCAGGACTGATCGTCTTTTCAGACAGTCCATGGGCATCG
CCGATCGTGATTGTGATGAAAAAGAACGGGATGGACATCCGGCTCTGCATTGATTACAAGATGGTGAATGCTATCACCGCGATCATGGAATATGCAATGC
CGCTAGTCGACGACCTGTTAACAGATCTCGAGCGCTACCTATGGTTCTGCTCGCTGGATGCAGCAAGCGGCTTCTGGGCGGTCATGATGACCTTGCGAGC
GCGTAAAGTATCGGCGTTCGTCTGCGCACTCGGACATTTCGAGTGGTTACGCATGCCCTTCGGGCTAAAGAACGCGCCGATGATCTATCAGCGTATGATT
GACAACGCACTCTGGGGGTTCGTTCAGCCTAAAGGAGGTTGGTTTGAATACTCGGAGAAGATGCGTTTAGCTGAAGAACAGGCCAAGGAACGTCGTGGGC
CAAGCGCCGAGGGTTCGTTTCAAACGAAGTTCGCGGCAGACCGCGAAGCACCGGTAGAGACCGACCCTGTACTACAACTCGTCAACAGCCCCGTCGCTGA
CATGTTTACGAACGGGGAGCCAGACGAATCATCGCTGGTACCTGTATTTGGTCGACGGTCGTTTGTGGATGACATTTGCTTCGGTGGCGAGGATTTCGAC
AGCTGCCTAGCGACGCTGGACCGATTGCTAGCAAGCTTTGCACAGTGTCGGATCAGCATTAGCTTCACCAAGAGCATCTTTTGGTAACCCAAGGTGGACT
TTCTGTCGCATAAAATTTCGCCAGAAGGTATCAGAGCTGACCCCAAAAAGCTTGCGGCCATCACCGAGCTTTCGTTTCCAACGAGCAAGAAGGGCATGCA
GTCGTTTCTTGGAGCGGTTAATTACTACAGCCGCTTCATTCAAGACTTCGCGGTCTACGGTGCGGCGCTGTACCAGCTCAAGGATGAAGACTTTGTCGTT
GAAGGTGGCCTTTCTGTGGCACGTCGTTCCTTCAAAAAATTGAAGACGAGTGTTTCACATTCACCCATCCTCAGGCACTTCGATCGGTCGAAAGAAGTTC
ACGTCATGCTCTTTGCGAATGAATGGGCGTTGAGCACTACGCTAATGCAAGAACATGAAGGCAAGTTACACCCCGTACGGTTCCTCGGTCGGGTGCTTAA
GGAAGCCGAGATGAACTACCATCCTGCTGAGAAGGAAGTGTTGGCGTTACTTCTGCTGTTGAAGATCTGTTACGTCCAGCTGGCAGGAAAGACGCTACAT
GTCTATACACGATTCTCGACGTTAGAGTGGGTGCATAAGTCGAAGTCTCTCTTCGGACGCGCGGTCCAGTTCGCAGTGCTGCTATCGCAGTGGCACCTTA
AGGTGCAGCGCGTGAAGGAGAAGGATGTCGCCTTTGCGCAGCTACTGCAGTCAAGCATCACGAGCTTTTGTTGACCTGGAGGACTCGCTCGCGCCGGTGG
CACCTCCAAACAAGGGTTCCCCGACTGTTCGAATGGACCCCGCGTTGCTGTACGCCAGGCTTTCCCGTAATTACAGCGGATTCGTCATGTCTTTTGACGG
ATCAGCGAAGACAGAGAAGTACGGTGGCTACGGGAGTTGTTCATGGGTGCTGTGGAGCCTTCCTGAGTGGAAGGTAGTGATTGCTGCAAACGCTTACCTC
TCGGCCACCACGGTGAATGAGGCAGAGTACACAGGTATGATAAACGGTGTCAAGGCTGCTATTGCGCACGGTGCCGAGGATTTAGTCATCGTTGGGGACT
CAAGGCTCGCGATTCAACAATCACTCGGGGTGATCGTATGCAGGAAGGAAACTTTGCTAGCGCTGCTGAATACTCACAAGGAACTCACGGCCAAGCTTCG
ATCAGTTAAATATCTTCACGTTGTACGAGAATACAGCGCGGCCGCGGATTCGTTAGCCACTGAAGCGCTGGAATCAAAGGTCAGTCGGGTAATCTTGGCT
GAAACTCGCAAGTCGGAATTGGCATCGCTGAACCGCATCCAGGAAATGATCTACGAGCCGGATGAAGACTCGGTAGATGTTTCGTCACAAGGAGCAGAGC
GTCAAGTACATGTACTGTCAGGCAGCGAGTCTTCAAAGTGGAAAACTTTCGAAAATTTCGTGGTTGATTACAGCTCACCAAAGTGCGATTATGGTAGTAT
AGCAGTGATGACCCGGCGACAGACGAAAGCCAAGAAACGCGTCAGGTTTGCAGATGAACACTCGGAGGATGTCTCAAAAGCTCAAGAAGAGCATGAAGAA
CGACGAGAGACGTCCACCGAAGATTCAATCGGCCAGGATTTGCCAGACCATCCTCACAAGACTGTACCAGCGGCATTTCCCGATGCGGAAGATGTTGACC
CGGTAGCGATACAGCGGGAGCGACGCAGACGGATACTAGTGGCACAAGACGAGGAACAGAAGTGGTTTAACATCAAGAAGGTGCTTCAGGGCCAAACACA
AGAGCTGAGTTACAAAGAAGCTCGAGATGCCTGGAAGTATGCTGACCGGTTCGTGTTATCAGAAGACGGCGTGCTTCACTATCTTGGATTGAATCGTCGG
TACGACCACGGTTGGCAAGAAGAGACCAAGCTGCGGCTTGTGGTACCAACAACGATGATTCAAGAGGTCCTGCAAAACTGTCACGACTCGCTGGAAGGAG
GACATCAAGGTGTGGTGAGAACGTTCCACCGCGTTAAGTCCGATTATTATTGGATCGGCTTGTACGCAGACATGAAGAAGCACGTGAAGTCCTGTCCAGA
TTGCAGCTCGAGTAAAAGCCGTCCACAGTTTCGTGGATACTCACCTGGCAACGTACTAGCCGAACGACCTTTCCAGATCGTCTCGATGGATTTTGTGATC
CCACTACCGAAATCTCGCAGGGGCAACACGGCGTTGCTCCTATTTCAGTGCTCGTTCACGGGATTCATTATTGCCAAGGCTATGTCAGATACGACTGCAC
TGAGTGTTGCCCAAGTGTTCGAAGAATGTGTGTACCGATGATTCGGAGCCCCATCATTAATAAGGCACGACCGCGACCCACGCTTCATGAGCGAGGTTTT
CCAAGCATTTGCAGAGATGATGCAGTCAAGATCACGAGCGACTTTGAGCTATCGGCCACAGGCTATGGACAGCAGGAACGCTCGGTGAAGTCGGTGATGG
GATCCGTACGGGTGTACGCGGAAGACCCTCTACAGCAAGATTGGGACGAAATCGCGGAGAAGCTAGTATTTGCTATTAATACTTCTCAAGACACTACGAG
GAAGGAAACGCCGTTCTACCTCGCTCATGGTTGGGATGCGCAGTCGACGTTGCGGGCAATGTCGTCATCACTCAAACGAGGACTCGGCAAGCAGTCTGAC
GCACTGGCGTGGCGGCGCGAGATCAATCGACAACATGAGGTCGCCCTCACTATGGCCAAAGATTATCAGGCTGTAGAAAAGGAGCGAAGGGCTAAAAAGC
ATAATGAGGCCCTGAGTCGACTGGAAAAAGCTGCTGTACCTCAACTCAAGTGGAAACGAACACTCGGCGAACCCTCCAGAAGCTTCGGAAGAGATGGAAG
ATCCTGCAAGAGCTCCACCGAGATCTCTTTTTGAGATTGGGAGCCGGGCGTGGTTGTACATGGAACGAGTCAAACCGGGCTTGACGAAGAAATTATCTCA
CCAATGGCATGGACCTTTTCGGATCACGTGCAAGGTGGAAGAGTTTGCGTACGAGCTGGAACTGCCTGATCGAAGTGGGTATCGCTTTTACCCAGTAGTG
CATGTGTCAAGACTCAAGGCTGTCACCGAATTCAACAGTCGACCGAACACTCGGTTGATACTCGACGCGACTAATGAAGCAAGACTCGACTTCGATGGAA
GTCTACTGCCTGAGGACAGCTGGGA