Description :
From Genome Similarity Track
Location :
Scaffold_1238:7870- 10958
Transcript NameFunction/comments
Phypl_g12853hypothetical protein PHYSODRAFT_552558
Phypl_g12854conserved hypothetical protein

Sequence
3088 bases(100 bases per row)
GAGTGCATGAAGTTCAACAGAATGTGCACCTCGTCTGTAGATCGACTGAATGTTCTGATTGTGTGCGCGGACATCATATGGCACCAACCTGAGCCGGAAA
TTCGAAACAAGGAATGGCAGGATTTTGAAGTCTGCTGTATACAGCAATGATAATTACCCGGATATCGATGAGATCCTTCTGATGAATTTGACCACGCAAG
AGAACCGTGCCGAGTTCTTTGATATTCAAGGCAGGGAAGGCCTCAAACAGGCATTGGAGGACGTAATTGAAAAGACTCAGGTAGAGAACACCGCCCTCAT
TTCGAGCTAACATGTTGAGACTTTGGACATGGCTCACGTCCTCCGACGTGTTGATTGTTTGCTTCTCTAATTTCGTGGTACAATATCCAGGGCCTTATTG
GGTTACGCTAACTGCCAACAGCCACTtgaaaacaaaacaaaaatgCATTTATTTTACCAATTAATGACATTCACAGGGTTGTTCTCTTGTTTTTCGTGGA
CTTCGATTCAGATTATCTCGGTCCGGCTCATGTCGGAAAGGATGACACGTATAAGTCTTTCGACATTTTCTAGCCTCTTCTCGTGCTTGCCATCAGTAGC
CAGACCGATACGAGTTGGAGGCAATTCCATGACTCCCATTTAGTTGTGCTGCAAAGTTTTCCATTATCCCGACGTGACTGATTTGTGTTTGTGTTTCTTA
GCAATAGATTTCATGAGCTATGACAGTCTGTCAGCTACACCAACAAAATAGCCTAATCAAACTCGCTTGTTAGGCTAGGCTAGAACTGCGAACCCTGTTT
GTTGCCAATCCCCTTCTCGTTTGCGTCCTTCCAGTCATCCCATGCTCGATCCTTGTATGTGGACTCCTCCACTAATTtttcgtcatcctcgtcgccgtcc
tccaggagctggtcgtACCGACGCGGTCCCTGTGGCGCTTCCCTGTAGCAGCAACACCAAACGGCAACCCGTTAGAGAACTCCACATCATTCCACCAGCC
AAAGCAACCACAACGTACTGCTCTCTCTTCTGCCTCTCCATGGCGTCCGCCACCTCCCGATCCGCATATTCCTCCAACGTCATCGTCGGTAGACGGTGGC
CAGGCTTGAACACGCCCGACCGAATCGTCTCGCGCCGCATCTCCATCTGCGGGTTGATCCGCGtcacctcctgcagcaacaaccaaACAACACAGCACAG
CACAATACATACATACATCAGTTCCGTCAACTAGGACCTCCTAGGCATGCTCAAATATCGTCGCTTCAGCCGTACAATTCCCTGGCCctgtggtggtggc
ggcggtcTGTGCACCCCCGAGAACAGGTCCTGCTTGTCCGTGGCCGCGTTCATTTTCAGCATGGTTTCCAGCATGTCCCTCTCCTGGTTGATGctcgcct
gctcctccatgCTCTTGACCACCGACAGCTGGATGAATgtcaggagctgctcgcgctccaggtcctcggcgtcgctctcgtcctcgtccagctcatCCGC
GTCCTCGTTCTTCGCTCCGCCCACGTGGGCATCGCCCTTCTCCTCGCGCCGCCTctgcacgtcctgcagcttcttctccatctcgcgctgcagctggaag
cgctggatCTTCTCGTCCCTCGACAGCGAGAACTGCTTGCTCTCCAGGCACTCGTACTGCTCGCGccgcttcttgtccgtcAGGAGACCGACACCCTCGG
CACGGTCCAGGAACTCGGTCAAGAAcacgtcggcctcgcgcAGGAACTTGATGCGGTACACGACGTTGCGCGTGTGGTCCGTGGGCCCGGAGCgccgctt
ctgctgctcctcgctctgctgctgctgcggcgcctccgCCTGCTGGAAGAACGTCTGCTTGGGCGTGAGCATGCCCATGTAGTAGTCTGCGCAGAAGGCG
TAGAGCTGCGtgttctgcagctcgaagaagcgctcgttGGTCGAgagcacgccgtccagctgccgctgctggataCACTTCCTCATGTAGAGCAGCGCAC
TGGTCAGCTCGTCCTGGAAGGCCTTGGAGTTGGGGTCGGACACGGCCGTGCTCGGActctccagcgccatgaagCGGCGGTGCGCCTCCACGTAGCTCAC
GCGGTCGGGCAGCGGCGTAGACGAGGAAGCCATGACCACCGACAGATGAGTGCGGAATTGGCAGAGTGATGGTGGacttgcagctgctcgtgtaGACAGA
GGGAAACCGCTCTTGTACAGGGAGGTGGAGTGGCCCACGTAGGTTGGTGTGAACATGGTGCTAATATGGAGTTGCACATGGAAGCCAAGACACTGGTGTT
GTAGACAAAGGTGAAGGAGAATGACGCTAAGATAAATGCAGACAAACTTTGGATTCATTCTGGCGGTGTGGAATCTCGCGTTGCGTTACAAAGGGGAGCA
TCTGACGCGAGCCGCAGACAAACATGTCGACCGCCTGCCTCAGCGACCAGCGTCCTTGCGCCGCCTCTCGACATCCCTTGAGCGAGACGCCAGCCTCTCC
CTCGTCTCTTCACGTCCGCTCTTCTGTACTGGACCGCAGTCGCGGCGCTTACTCCTTCTTGTTCGTGCCCGTGGCCATGCACACCTCGCCACGGAGGATC
TGGGCGAAGCCGATGCCCAGGCCGAGGAACATGGCCGCGAGGAGCGGGCCGTCCGACTCGCGCTTGATGTAGGTGGGGCGCTTGACGGTGGCGAACAGCT
TCTGGTCGGCTGCGACGTGGCTCTCCTTGTTCAGGAGGCCGGAGTAGGCGCGCGTCTGGCGGGCAACGCGGATGGTCTGGCGGGCGAGCATCTCGGCGGA
GTCTAGGGTCGTGCCTGGGTTTCTTTTCTTCACTGAGGGCGCTGGGGGCACCAACGGAAGGCAACAAAGACAAGGAACCGCAAGGACGACCTCACATTTC
TATGCCAGTCCAAACCCTGGGTTTACGAACCAGTGtcgtactgctgcaggtTTCAATATTTAGAAATAGAAACGCAAGGGTCAAGTTTGCAGGGTGACTG
AATACTGAGAGGTTGGTATTTCTTATTTGAGTGGTAATTATGTAGAGATGGTGACGGAGGGACGGTGACAGCAGACAACGGTCAATTA