Description :
From Genome Similarity Track
Location :
Scaffold_39:78691- 80236
Transcript NameFunction/comments
Physo_135537hypothetical protein

Sequence
1545 bases(100 bases per row)
GCGTCACGCACAACGTGTGGACGGCCTACGTCTTCACGCTCTTCTTCTGGTCCGCCCGAAGGTAGAATGCCCCTTTGCCAACCAAAATGTATCAATCCCC
TCCCTCCTTGCATTAACGAGCCATTGCCGCCAGTATTCTGTTCCAGCAGGTCGTGGCCGGCTACGTGTTCGTGCTCACGGCGTCCAACAAGCCCGTGGGC
ATCGTCAAGGGCATCCAGGGTATCTCGCAGCTCGTCTTCTCGCTGCCGGGCGGCTACTTCGCCGACCGCACGCGGCGCGACACGATCCTCAAGCTCTCGG
GCGCCATTGGCATCGTGGGCGCCGTCATCACCTTCCTCTCGGTCGAGATGACGTCCGTCACGGGGCTCTACGTGGCCTTCGGGCTCTGGGGGCTCTTCGC
GGCCTTCCAGAGCCCCGCCATGGAGGCGCTCTTCGCCGACTCGATCCCGCCGGGCAAGCGCAGCTTCCCCTTCATGATCAAGTACAACATCAGCAACCTG
GCGCAGATGCTCGGGCCCGTGCTCAGCATCTTCCTCTTCCTCTTCTACGGCGACGAGTGGCAGCTGCCCGAGCTCAAGCCCGTGCTCGAGTTCGGCTGCG
TGCTGGCGGTCGTGGGCTCGCTCGTGCTCTTCCAGTTCGACGACGACCGCGCCAAGGACTACATGCTGGACAAGAGTCAGGAGGAGAAGGAGGAGGAGGA
GCTGCTCGAGAAGATGGTCACGCCGTCCCCGCTGCGGACGCCCAAGCTGGTGGGCAACGGCGCCGAGATCGACATGGTGTACGACTACTCGGACGAGGAC
GACATCACTGTGGACGACAAGTCGCCGCCGACCGCGACGGAGAACACGGCGCTGCTGCTGCTCAAGGGCAAGACCGCCAAGGAGCTGGATCTGGAGCGCC
AGCAGCGGCTGCAGCAGGAGGACGATGACGAGGAAGAAGGGTACATGGCCCACCTGGACGCCAAGTTCCTGTGCTTCCGCACCAAGCACGTGCCGTACAT
CCTGTTCGTCTCGGACTTTGTGATCAGCAACGGCGCCGGCATGACCATCAACTTCTTCCCGCTCTTCTTCAAGGAGGAGTACGGCCTCACGCCGATCCAC
GTCTGCGCGCTGTTCATGAGCCAGCCGCTCGTCGTCATGATCCTGTCGTTCATCGCGCAGCGATTGTCCAAGCCGTGCGGTCGCATGCCCATTATCGCCT
TCACGCGCGCCTTCTCCGTCGCGTGTCTGTTTTCCATGGCGTACGCGCAGCCGATGGCGCTGCAGATCGTGCTGTTCTTGATGCGTGGAGGCATGATGCG
CTGCTCGCAGCCTCTGCGCCGCTCAATCCTGATGGACTACGTGCCGAAGAACATTCGTGCGCGCTGGAACGCGCTGGAGGGTTTGTCGGTGTTCTCCTGG
TCGGGCAGTGCTGTGCTTGGAGGCTTCTTGATCGACGCGTACGGCTACCGCATGTGTTTCATTATTACGTCGCTCGTCTACTGCGTGGGCTTGAGCATGG
AGATGGTCCTCTTGCCACTGACCAAGCACGCGGTTGAAAGATAGA