Description :
From Genome Similarity Track
Location :
Scaffold_117:78683- 84388
Transcript NameFunction/comments
g15509.t1hypothetical protein
g15510.t1hypothetical protein
g15511.t1XP_008908959.1 hypothetical protein, variant [Phytophthora parasitica INRA-310

Sequence
5705 bases(100 bases per row)
GCTCGTTGCCATACTTGCGAGTATGGGACGTGAACGACTTCATTTTCTTTGGATCGCCACCAAACGCCGCCAGCACAGATTCCAAGATGGACTTGTGAAG
CAGCTGGGCCTCTTCTCCGACCACAGGCTCGATGTCCTTTATCGGAAGCGGGACCGTGACCTTGTTGCGTCTGCGACCCGCCGATGAGGACCCCGCCCTC
TCGCGCCCTTCGGACGGTGGGGACACCAATGAATTGCGTTGTTGTTTCTTCGACTCCTTCTCTTTCTTCACTTGCCCCTTGAATCGAGCAAACGCCTCTA
GCAGCACACTCTGCTTCTCTTCGTCGGACAGAAGCTTCGCACTGTTTGGAATAATTTTACCTGCCGTTTTCGACCCAACGCACTGGCGCACTTGGTCACA
AAACTCATCAGCTGTGATCTCATCCAAGCCAAACTTCCGCGATGATTCCTTAAACTGCTCGATCACTGCGTCTTCGTTACCTGGCGAATGCTTCCCAGCC
CAGGCGGTGATGATGGACATAATTTCGGCATAAATCGCCTTGGTCTCCTGCGAGTTTTGCTGCCGTTCTTCTTCCAGCCGCTGGCGTTCTTCGGCCTCGT
GCTTTAATCGCTCAGCCTTCTCAGCCACAGCAGCAGCACGCGCCGCTGCAGCCTCCTCATAGATAGTTTGATATTCCTTCGTCTGATTTTGACGGTAAGC
CTTCTTGAACTCCGTCACAAACTCATCCAGGATATTAAAGAATTCCATGGGGCCAACTTTTCGTGGATCTTCACCAAAGGAGCTGACAAGCTCTTGATAG
CAAGTTTCCAAGCCGTTAAAATCGCGTCCCAGCTCTTCCAGTACCTCTTCTGCATCCTTTGCAAACGGAGTCATCACCTCGTAAAACTTGTCACCCTCAA
TGTGATCATTCTTGGACGCACGCACTTGGCCCTTCAGCATAGCTAGCTCGGTGTTGTAGGACGACAGATCGGCGCGTAGTTGATCAAGAGACAGTCTCTT
CGCTTCCACAATATGGGGAACTTCTCCAGCGAAAGTGATGACATCAGGAGACTTCTCTTCCAGCTGACGCAACAGGAAGTGCATTAAGGTAACACGAGGA
TCAACCGACTTCAGCGTGTGCAGTTTCATAAGAGTGTCCAGCTTAAAGCCATACGCGCCACCACGAGGAGTGCTACCATTCAAATAGTTGCCGATCGCCA
AAATGTGCTCCAGAACGCGGCGGAACTTGTCACTTTCAGCCACTTGGTCCGTAGCAGCAACCAATGTATCCAGCTGTGCCTGGGTTTCGAGGATGCGATT
CTCGAACTGTAACTTGTACCTGAAGCACTTGATACGCTGAGTATAGCGCGGAATGGTCAGCAAATCAAGGAAGAACTTCTCAACATTTCCTAGCAGCTTT
ACATCTCCATCGTAATTCTTGAGCATGTCAATCTCTTCCAGCGTAGGAGAGATAGAAATGAGCACGTTCAGCACTTCAGACCCCAGTTTCTGCCCGTCCA
AAGCATAAATTGCGTTCTTGATATCCTCTGATGACATCTTAAACCGAGCAATGGCGATGGACACATTTTGCTGTCTCTTCGGGTCAAACAAAAGTACTTC
CTTGGGCTGTGCCAGTACCTTCTCCGCTTCTTTCTTCTTTTCATCAATCTTTTTCGACGCGTCCACCGGGTTTTTACGGAACATCCACTCCATCTCGTCC
ACGTCCATCTCGGCATGCGAGTCGTTCAGTTTCATCCACACAGTGCTGCTAACTACATTTACAGGCACGCGGGTCCAGAACAGCGGGCGCAATTCAACAT
TCGGCTTCACGGTTTCCTTCTTCGGCAGCTGAGGCTCCTCGGGCTTCTTGGGTGCTGCTTTGTTGTTTAATTTTGAGGCTAAACTTGCTTTCAAAGCCGA
TGGGTCCACCTTCACCGCTTCTGTTGGAGGAGGGAGTCCTGAAAGAAGACCGCCGCCAGCACTACTGCCAGCTGACTTCTGGTTGGGTGACGGCGCATCT
GGCGTGTCCAACAAGTCCGCATTCAAGCCCGCGGCGATCATCTTCATTTTTACTTGCTCGGCAGGCATACCCATCTTCACCAGTTTAAAGAATTTCTCGT
AAGCTGGATCTTCTTTCACGCTCATCACCTGGTTAGATGCTGCCGCTGGTGCGATAGCGCCCGCGGAACCGGGCATTGGTGCATCCGGCGTATCAAGCAA
GTCCGGATTCAAACCACCAGCGGTCATTTTCAGCTTGATCTGTTCAGCAGGCATCCCCATCTTCAGAAGCTTGAAAAACTTAGCATACTGCTCGTCATCT
TTCACCAGGGCACCACCACTCGATACAGGAGCAGCTGGTGCACTATCAACACTTGGTGCGGCACCTCCAATAATCGCACCTGGGTCATCGAGGACCGAAG
GATCAACGCCCGACGCCTCCATCTTCAGTTTTACCTGTTCATCAGGTAGACCCATCTTCAGAAGTTTGAAAAACTTCAAGTAGTCCGGGTGGTCTTTCGC
AGCAACACCCGTTCCATTGCTAGTAGGTCCTACCGCTTCGGGTACTGATGCCGCCTGAGTTGCCGGGCCCAATGCACTGCGATTGTTAGCCTGGGCTTCC
GCAGCAGCCGTTGCAGCTGCAGTTGCCTCTGACACTGCGCGAGCGTGCTCCTCCTCTCTTTCTTGCCGACGACGCTCTGCTTCGGAGATCTTATGCTTAA
ATTTCTCCACACGAGTTCGCAGCTTCTCGTTCTCCGCCTGCAATTGCGCCACAAGCTCCTCATACTCCTTGGTCTTTGCAGCTGTATATTCGTCCCCTTC
AGGTGCCGCCACTTCCACTTTTTTCTCCACCGGATCGTGATCCTCGGGCTCCTGTTCAACCGGCGCATCGTCTTCTGATCCGTCCGTCGGCTCCGTCGGC
GACCCACTGTGCTCGTCAATGACCAGGAGGTTCGTCCCCAGTGAGTCGCGGAAGCCGCGATTGCCTCTGTCTATTTCTGCAGCGCCAACGCCGTCCACAC
TCACCGGTGACATCACCTGCTGCCGCACAGACGTGCCGCACTCAATGCAGAACTTGACGCGTAGCGGCAGTTCATAGCCGCACTCGATGCAGAACTTGGC
CGTGCTGGTCAACTAGTCCGCACCAATTTGTCAGAGGGCACAAAACCGTTAGAATCCGTCAAAAACAGGCACTTCAACTTGCACAAATCCACACTCACAT
TAGTGACCTGCGGCGCGTTCGTGGGCGCGAACGACGACGAAGACGTTGAGAAGCTCCGGCGCTTGCTCGCCGTGGGCCGCGAGCCGGTGATCTCGAGCGT
GGCGTCGTCGTCCAGGCATCCCAGGCAATACCACTGCGGCCGCGAGCGCACGGGCTTCTTGCGGTCGACGGCCTTGCGCCCGCACTCCTTGCACACGGCG
ATGTGGCAGCTTCGGCAGTGGTGGCGGCGTCGCAGGATGTTGAAGGACTTGGAGCACACGCCGCAATCGGGCTCGCGCGCGAACGCGTCGTCTGGCGCCA
TGCTGAGCTTGCTGCTGAGCGAGGCGCGCGAGCGGGACGTGGTAGGCGTCACAGCAGCGGCGGCGGCCGCGGCGGGTCCCAAGCCGTCGGCGTTCGTGGG
CGAGAACAGACCTTGGCGCGCGCCCTCCATGCTCGGCTGCGGGTCGTGGAGCTGCTCGATGCGCGAAGCTCTTCTTCTTCTTCTGACTCCGGGCGGCCGC
TTCCTCCCTTGCATGGACACGCATCAGATCTTGCAGGTTATGTGTTCTCACGAGATATTGGACACATGTCGCAGGATTCGCTCCCAGGGCATGATGACGG
CACCAACAACTAGCTCTAATAGCACACTTATCGCCAGTGCTGGGCTTGGCACCCCCGGATATTTTGGCGCCCGGTGGACTCGCAGGGCTTGCAGGTGCGC
TGTCCACATTTGGAGTAAGCGATGCGAGGAGGCCATGTCGGCCGCTTTCGAGATGTCGCTGCTGCCAGGCGCGTTGCAGTCGAATGCTGTTGTTGCGGAC
GCGATTGCGCCGAGCTTCAATGGCGTCGTGCCGTCCTGCTCGCTCGCTGGTGGCATGGCGATCGTCGAGGTGTCGCTGCTCACCGGCACTTTTTTCGTGC
GGCAGTGCAGCGGCTGCACACCGCCATGGGGGAGAGTTCAAGCGGGTTGTGCTCTCTGTTGATGCAGGAAGCGTGCAATGTTGCTGCCAGAAGTCGAGAC
AACGGTGTGAAGCGTGAAATACGTGAAGTATTGTCGGCGTCGAGGTAGGTAAGCAGATCCGACTGCAGGTCGCTTTACCTTGCTGAGCAGGCTACCAACC
AAATGGTGCGGCGCAGATGCCCGTCCAAGCTGCGCCTCAAGTTTAAGCTAAAGGACCCCTCAACGTGGAAGGCGTCGTGATGTTTGCGAAGACGAGTCGA
CCATAAGGTCGTTGAGATCAACAGTGGAGACGCTGCTCAATTAGTCGATATCATGAAGAGGCAGATAGGCTACGGCATGGTCAGTCCACCTTGATGGGCA
ACATCATCGTGAGGACACGTCTGTCCTGGACGGGGGACCAAGCTCTGCTTGCATGCGGCTCGGAGGAGTTTCCTGTCAGAAAGCAAGGCGCGGACCACCG
CCTCGTTCGCCTATTGCGGGCATTAGCAGCCGATGAGCGCGCTTCAACGTGTAGCCAATCATCTTGAAGAGGGTTTACAACCTATCTTGTCGCATGATTA
TCCCAAAAGTAGTCCATTCGCCAGGTCAGTGCCAGGACACGCACGGAAGCAGCGGACAGAAAGCTCCCAAGCCTCCGCCCATCAAGATGCTGTACACGTT
CCTCCAGAAGCTGCCGCTCAGCCAGGGCGGCAAGGTGTTCGTCGGCACGTCCATTTGCCTCGCCATTTGTGCCTACCCCGTCATCCGCAAGCGTGCGTCC
CCTCATCTATTATCCGCGTATCAATCGGCCACACTAACTGCTCCCATTGCTGCCTTCCTGCAGAGCAAAAGGCCGGCCACGACCTCTTCTCGTCCGAGAG
ACCGCAGGCCATTGTGGACCAGGAGGTCCAGGCCCGTCGCGAGAAGCTCAAAATCGAGTAAATTCCCTGTGCAGCAACTTCAGATTCTCTTATCTGCAAG
TTCAGTTAGAACTTCTTATTCGGACCTCTTCGCCAGTGGTGGAGAATGGAATATACCAGTGATTTCCCTTTGCAGCTTTGCTGTGCTTGGTCACATCATG
TTGTACGACGACACTTGCACCTTGAACTGCCCCGGACCTTTCTTCAGGATGTAGCACTCGTTACGGAGGATGTCGACGAAATCCCGAAAGTCGTCCACCT
TGAGCCCCATGCTGTCGGCAACTTCGAGCAAGTCGTCCATGGAGAACAAGGACGTGTTGCGTCTAGCTGCGGCTTTCATGAGCCGCGCCACGTACGCCTT
CACCTTCTTGGCCAGACTCATGCCTCCGCTGCGGCCAAAATCCAGGTTGCCATCCTCCGTCGTGTACGTGTCCAGCAGACACTCTTGCATGATGTCAACC
ACGTCCTGAGCATGCTTCGCTGATACCGTTTCAGCCAGTTCGGCGCGGGCGCGAGCTTGTGAAAGTCGGATCATCGACTCGAGCTGACGCGTTGTGATCG
GAATGCTGTCTGTCGGGTTTTGCTGGCCTTCGCCCGCTGAACGCAGTTCCAAGTACTTCTTCTGGAGCAGAGCGGCGGCGTCAGAGGACAGTCGCGGATG
CACGT