Description :
From Genome Similarity Track
Location :
scaffold_503:7868- 9138
Transcript NameFunction/comments
Pl_104294hypothetical protein PHYSODRAFT_339105

Sequence
1270 bases(100 bases per row)
AAGCTGAACGCGGCATCCTCAGCGTGTGACCCGGGAATGCTGAAAAGCGTACGGATGCGCCAGCGCAACCGCATGTGGCACAGACCTGAGATGACAGCGC
ACAGCCAGAAGAGGAAGTCGAAAAAGCCACTGTGGGTGCTCACTGCGATGATTGCCAGCAAGTAGAGACCTCCAAATATACCCAGGACGTGGTAGAATGG
CATCAGGCCGAGGCGAGCCGAGATCTGAGCCACCACGAGACCGGGGCAGCAACAAGACATAACACCTAGTAAAAGAAGCACAAAATGTCAGTGGATGTTC
AAGATGAGTGTCGACAGAGTAGATGAGTGCGTACCATTGGGCACCATTGAATCAGTGAAGCCAAAGAGACCAGTCTTCCAGCGGCCAGTCACAATGCCAT
TAGAGTCGACACCTTGGCTGTCGCCATCACCGATGTTCACCGTCACGTCGGCTTCCTTGGTCGGTGGTTCGAACTGCATTGTTATTGAAAGTTGTTTGAA
AAGTTGTTGGCTGTTGGTTGACGTGGGAGATTGAGGAATGAGTTTCAGGAGAGTGCGTTCCAATGTTCGCTAGGGCTTACTTGGGAGATCGTTACCATTA
CTGCTGATTGATCACCTACCGTCGAGTTCTGATCGCAAAGTGCGTGCCTATCATTAGGTCTTGGAATACGGCAGAGCAGTATGCACGGAATATTTCCGGC
TCGGCAATTAAGGTATCAGTCGTCCTCTCCACCGCCAACTATATCCATCTCGCCAACGGAATCACTCATGAGTCGATAGGAATAGCTGCAATCATAATCA
TTCGAGGCACATTGAAGCATAATACCCACATCGCATAAGACGACTCAACCTGCTTGCATATTCCATCCACACCATGCTTTCATATCTACCTCGGCTCATA
CAGCGCCACCACAACTGCTAGTCTAATGCAGGAGAACTGCTACATGCCGAAGACAGACCGGATCTTGCGGTTAGCACCTTCTTGTACGAAAGACTCGTTC
TCAACATCGCTATCATCATCGTCGTTATCGTTGCCGAAGAAATCCATCTCATCACTAAAGCCTCCACTCACTGCGCCAATTCGCTGACCAGATTCGAGGT
CGACTGCCACGTGCATGTACCGCGTCTCGTTCATTTTGTTCTCCATGGCATGTAGCTTACGGCGCAGATACATGAAACTTCCGAGTATAACAACCGAGCA
GAGGACCGTTGGAAGCACAACTTGGTAGAATGTCCGATGCGCATCCTCCATCTTTTTCGTCACCAGTGCC