Description :
From Genome Similarity Track
Location :
Scaffold_21:7864- 13692
Sequence
5828 bases(100 bases per row)
GCACATAGAGAACGTTTGCTCAGCACGAGTGCCCTTCGATCTAGTGCCTCCAAGGCCGACGTTCGGCAAGAGCGCAAGCTGCGCTATGAGTTTGCTAAGC
TAAAGACCAGAGGTCAGCTACGTTCGTTGTATCGCACGCAGTACGCAAAACCAGTTGCTGGTCCAACCACCACTGTTTCGACTGTGCAGACAGTCGCGGG
TCAATCGGTGTTGGTGAGAGAGCCCTACACCCCCACACCTATTGGTGGGAAGCGCGTTGGAGTGCAAGCTGACCCGCAGCGCGACGCTCAAAAACGTCAA
CGGCGTGCGGGCAATCTTGCCGAAGAGTACGTCAAAATCCCATGAGTTTTCAGACTCAGGGTATCCACGCCACTTCACCAGATACTGGTATTTATCTTTA
TGACGACGCCTCTTCATACTTCTCTCCACACGGAACTATAAGTTCCCTTGCTCGTCTAGCAGGAGGGGGTCGATGTGTCGGCACAGGCTTATAGAGACTT
GGTGTCAGAGGTGAAGCAACTCCAAAAGTCTTTTGCTCACGTGCAGACGGCACTGGATCAGTCTGTGACTGAGAGGGAGCAACTTCGGGAGAATCTTGAC
CAATTACAACGCGCTCATGAACAGTAATCGACTGAGTTGGCTCAGTTGCGTAAGCAGTTGAACCGTCTCAGTTCGATCGACTCGGTCGACCAGCGACTGC
GGAATGTTGAGTACAACCTGCCACGGCTGGATGGCCAGGTGGATATCTTGATGAAGATGCAGCTAGCGGGGACGACGTCCTACTTTCAGGCGCAAACGCC
TTCCGGTCCACGAGAGGAGGATCATGATATAGCTTAAGCAAGCCAACGCAAAACACCAGGTGTGCGCGCAACTTGCGCGGAAGATTGAGCGTAGAGGCAA
GGCCTTTCTTCGCTATGACCGTAAACAGCTCAATGAAGTGCAGACGCAATTTCGTCTTGAAGACGGCAGATACTACATTTGTAGGTAGGTTTTTAGCGTT
GGATAAGACATGGTCTCCAACTTCATAAGAATCAATAAATCCTCTACCTTTAGCATCACCTTGTTCTTTTTGTTTGTCTCGGCTATCATTCATTGCATCA
TGCACATGTCGTAAGACACTAAAGCGCGTCGCGAGAAGCTTGCTCACTTGTTTCTGCATTGTGATACGGCTGATTTCAGCAAGCTTGTCAGCAGACTCTC
CCCCACCAAGCCCAGAACCACGTAGTGGTAACGTGAGCGGAACGCGGGGGTACTCAATGACAAAGAGCATTGAGCTCCAAGTCTTAGGCGACTCAGCATA
AACACTGCGAAGAACGTCGCCAATGACGCGATTAACTGCTCAGTCTGACCATCGGTCTGCGGATGATCCGCTGTGGACATGTCCAATCGCGTGCCAAGCA
CCTTGACGATGGAAGTCCAACACTTGCCGGTGAAGCGAGGGTCGCGATCAGAAATGATTGCCGGTGGCAACCCATGTTGACGAACACACGATCGATAAAC
AGCATCGCTATACCTTTGCCATAGATGGAATTCGGTACCGCCGCTAAGTGGGTCATCCCACTTAAATGGTCAACAAAGATCACAATTACCGTATTGCCGT
CACAGTCTGTGGGAAGACGAAACACAAAATCCATACTTATGAACTCCCAACACCCCGTGGGCACAGGTACACTGGCGAGTGGTGCAGCCGAATGTACTGA
GGGTTTGACCCGCTGGCACGTTTCGCATGTACGCACGTATGTGCTCACCCATTTGTAGAGTTTGGTCCACCAATAGTGCTGACTCACAAAGCCATAGGTC
TTTTCGCGGCCCAAATGCACACTGAGGGCAGTATTGTGGGCCTCAAAGAGGATTCGATACTTTAATCCTCATCGTGAGGTACAACAATGCGAGCGGTATC
CGCTACATCTATACGATAGCACAAGCTCCCATTATCGATGGAATATCGATGTAGGCTGGCCCGCAAGCGTGCCGATAATTGACTGTCCAAGTCTTTGTGT
TCCTAACTCCCAAGGGAATGAAACAATGCCACACATTGAGAATCCCGCGGATATGCCACACGAATTAACTCCTCAATAGGAGACGACAAAGTCGTGACAT
GAGCAATCTCATAATCAGGTCTGCGAGAGAGGGCATCTGTCAACACATTTTGTTTGCCTGGCTTATACTTCACCTCGAAGTTATATTCCGCAAAGAAGGA
AATCTACCGATCCATTCTCTGAGAGAGGTGAGGCGACTGTGTTGCCGTGCGTAATGACGCATGATCCGTATAGACGACGAATGGCTTGGAGCCATGCAGA
TGGAATCTAAATATAACGAGCGCATACTTCATAGCAAGTATCTCTTTATCATGAACTGGATAGTTCTTTTCAGCAGCTTTCAGCTGACGATATTTAAATG
CGATAACTCGCTCGTGGCCTGCAGCATCTGTTTGTAACAGGGCGCTGCATTTAGCAAAATTGGATGCATTGCAGACAACACTAAAAGGGTAATCAGGATT
TGGCAACGCCAAAATGGGAGCATGGAGGAGACTCTCCTTTATTGCCCGAAATGCGTCGGCATGGGTGTTGTCACAGCGCCAATCTGTGTATTTTTTAAGA
TGATCAGTTAATGGCCGAGCCATATCAGCGTAAATTTCACTGTATTTGTGTAAGTAATTGGCAAGGCCAAGCCACTACGCAAGTCCTTTTGATTCATAGG
AATCGGCCAGTCCACTATAGCTTTGACCTTAGCGGGATCCACTCTAAGGCCGAGCTTACCAATGAAACATCCTAGAGAAGGAATCTCCTCTGCACCAAAA
ATGCATTTAGACGCGTTGGCGCACAATTTTTCAACATCTGACCGACCTTGTTTGGTACGACTATGGACAAAAATGTCATCAAATTACGTCTGTGCGTAAT
CCCTATGTGTGCGGAGAAGTTGCGTCACCAGACGATTAAATGTTGTTGGAGCATTAGACAGCCCTTGGGGCATCACTAGCCATTCCCATAGCATACCACT
CGGGATGCTCACTGCTGTAAGCGGAATATCACTCGCTCGCATGAGCAATTAATAATATCCATCGACCAAGTCAAGTGCGCTATACATAGTACAACCAACC
ATATTGTTTTGAAGAACATCCTTTCGATGAATGGGTGTCTGCGCCGGTATATTAGCCGCATTAAGCTTGTTATAAGCATGCACAATACGCCACTTGCCGT
TCATCTTTTCGACACAAAATGTCGGTGTCGAATGTGAAGATACACTCTCACGTACCATTACTGCCTCGTGCTTATCACGGAAGAAGTCATCAATGACATC
ACATTTCTCCTTAGGCAAGTGCCACTGTCGTGTGACACATTACTTAGTCCCAGGAACTAAGTCAATTTCATGACGGACACCTCTATCTAAAGGTAAAACC
GAGGGTGGGTCGTGGCACACCACATCTTGTAATTCCTTGAACAAGGAATGAAAGGGATCATGAGGGTCTTTCGATATTGATGACCCACTACGCGCACTGA
GTGCTGCTTTTGTGTCCTCCAGAACGGCTTCATCCAAAAGTGAAGAAGAGTTCAAATCTATGATGTCGGGTCGAATGACCACCACCTCTGAAAGGTTTCC
ATTCTTTAGTGATTGATCAAACTTATCGACCGACAACTCTTCGAGTTTTAAAAGCGAACTTAATGAGGGTATAGCCTCAAGGCTAATTGTACCACCACAG
GCACCAGTCAATACTTTTACGAGTGTATACTGCTGACAGTCATCATCACTTTATGACACAGCACACGATGTGTGACTCGTATCTCTCTGATCATTACCAT
CATCGAAAGTAATTTGGTCTAAACTAGAGCTGACGTCACTATTGACATACGATGACGAGTCATTTAACTATATTGCGTAATACCGTGGATTACATGCCAC
TTCACGCGCATCCAATGAGCCGGGCTCGGGATGTCTTTGTATTTAACCAATAACGTCAACATTGACATTGAGCGCGTCGCTATTACAGCCGACGTCACTC
AGTGGGGGTACTGACGTGCCACTCCACGCTCGTCTGATGGGTTCAACCCTCGACGACTTGACGCTTGTTCATCAATGCTTGAAACATTAATTGTGTCGTT
CTCACAACGAATATCACTTAGCGGAGTACGGGCCGTTTCAAAACAGAGTAACGAGCTTTGCTCGATACTCATGTCTTTGACATCAAAATCAATTAGTTCT
GACATTTCGATGTCTAGCACACTGACATTGTCAGCCAGTGGCTCACGCCAATAACGCTTCTGATTCCTTGTAGAGGTGGGTTCATGACTCTTCAAAGCTC
CGCTAGGGGCAGTGCGCGTGGCGCCTAATGTTTTCGACACTGCACCCAAAGTTCCTGTGAACTTCACACCCAAGTTCACAGGAACTTTGGGTGCAGTGAC
TAGAGTTCCTGTCGCCAAGCGAACAGTGATCGCATCACCCTTGTGCGCTTTTAGCACCTCGTGAATTCCTTTCAAGGGAACAGCGTCTGACATAATTACC
GGATGCTCCGGAGTCGATCAAAATCGACAAGGTTTTGTCAAAGCCCTTAACAGTCACCTTTGCGACCAACAAGCCTGGCTCCTATTCACGTCCCGTGTTA
GAGTGCACGGGACTCCTTGGGGCTAAACTATGCTCGCTACTACCTCCTAGAGGCTCAACAGAACCTAAATCTTTCCCAGCAGGGCGCCCCGCGCCAACTG
AGAGTCTACGTCTTCCCGTACCGTACCAGACTTCTGGTTAGCGGCGATAATTCGGCCTGAAGTAGCCTGGCGTGCCCTGCGTAAAGGGCAATTGGGTAGC
ATATACTTTGTGCTTCCGCACGTGAAACATCGTCGAATGTCTTATGCTGTTCTATAGCTCGAAGCTCTGCTTCTTCGTCCATCTCGGCGATACTGAGGTC
CAAAGGCTCCAGCCTATTGAATGAACTAAAGGAGCTCGCCGAGTTTGGGCTGTTCTCATGGGTGCCAAAACGGGCTGCTTTAAAGTTAAACTCAGCGTTC
AACGAGATATCCACAGCCTCCTCAAAGAAGTTGGGGTGTACCCGGAATACTTCTGTTCGAGCCACGCCCGTACGAAGGCCCTCCATGAAGATGGTAACCA
AAACCATTTCCGGTAAGGTATCAAGCTGCATGGCAGCGATTAGAGTTCTCAGTTCCTGGACATAGTCCGATAGTTCTTTCTTTCCCTGACGGGCAGATAG
GAAACGAGAACCCACCCGGTATGCCTGATTAGGTGGAGCAAACGCCTGGGATATTTGCTGTTTTAGCAAATCCCATGTGGGGAAAGCTTCGTCTACCGAC
GTGCTACACGTGAGAGCCCATTCTCTGGCTCTACCACCCAGTTTTGAGATATCCATCCCAGCTCGCTGTTGCTCCGACTGAAGCATAGCGGGGCCATTTC
CACCTTTTTGATCCACAGGAGGAGATTCTCCCCTTCTTTTCCCTCAAATGCCTTTACAGTCAAGACAAGGGGCCGAGCCCTTGGCTCTTCATGAGGTACG
GGAACATACCGAGTAGGCATAACCGATGCCAAATGGTCGTGTAATTGCCCAATCAAAGTGGACTCAACTGCATAAAAGCGTCAAGACGTGCACGAATCAC
TTCAGGACCTTGTGCAAGGATTAAATCCACTTAATCGTTCCCGACTAGCACTCTGAGTTTCTCCAGCGCTAATCTTTAGGCCTCAGAGACGTTGATCTTT
GTTTCCATCCTTACAGAGGAACAGTCTTTAACAGACTCAGGTGTAGATTGACTACAAGTGCTACCAAGTGTAGCGGGGCTACCCTTACTCCTTTGTCAGA
GGAAAGACTTCTAGACTCCTAGAGTCTC