Description :
From Genome Similarity Track
Location :
Scaffold_3:786337- 787715
Transcript NameFunction/comments
Aphas_H257_01847unnamed protein product

Sequence
1378 bases(100 bases per row)
TTGGGTGGTACCTGAGAGCTTGAGTTTCTGTCGCACGGTCGTGGGGTCACATACATACACAGGCCACCACGGCCCCGCGCCCCGCTTCACCCACGCCATC
GTGTCCACTCCCATGCTGTCGACCACAGGACTGCCGGTGGATTCACCAGTTGAAACGGCCTGTGACACTGCTTTTGTCGACGCGATCGCTACTGACGATG
ACGATGCTGTGACACTGGGCTGTTGCGTTGGAGTGTGGGGTTCAATAGAAATGCCTAAGATATCCGCCATGGCCATGAGCTCTGGGTCGGCTAGCGCGTT
GGCAAACTGGTCGATGGGGGCAGCTGGTTTGCCGACGGGTGACGACGAGTCCATTGACGCCTTCGTTTGGTCCGCCGTGGTGGGTGAGCTGATCGGTGCA
TCCACGAGATGACCAGTCGGCGCAATTTCACCGCTTTCTTCTTCTGCGGCGTCGTCGCGCTTGGGTGGTGCAGGGGCCACACGTCTGCTACTGCTATATC
CCTGGTCTGGAAGAGAGATTCGAGCGGTGTCGAGCGCTACATCATCGCTTGGCTCGGCCTGTTTGCCTGCGATGGCATCTTTTTCGTCGTCTTCTTTGCT
GGACATGGGAAGGACGGCGGTGATGACGCGGTCGACCAACGAGGACACGATCTCGGTAATCACAGTTCCATCGTTCTCTGACGTCCCGGCTAGTAACATT
CCATCTACTTCCTCCTCGTTGTTCTGGGTGATGGTGGCTTCGTCGGCGGCGGAATCGGACTTCTGTGGGGTCGCCACCGTGTCCGAAACGTCGGCGTGCG
CCGTGCCGTCGGTCGCGGAACTCGACGCCACGGGCTCGTCAACAACGTTGGGGCACTCCAACGGTCCTTCGCGTGGGGGGAGGTCAGACGCATCGACTGG
ACTGGGCTCAACTTGCGGAGCCCCAATGGTTGTGCATGGTTCGTCAGGCACTGCCAGGAAGGGGGGTGGACTGGCATTGGCCTTACTCCCAAGAGCAACT
CCTTGTGGAGGTAGTTCGATGCCCCCGTCGCTTGGCTGACTGGGCGGCGGCGGAGAAATATGGCACTCGTCATTGTCGTCCCCATGGATTGGAGTGGTAA
GGCTTGGCCCAGTTGGCGAAGTAATGTCGACGGTACAAACGGGGCCAGGAAGGTCGCCGTCTGCCTTGGCACTCACGAGTTCGCGGTTGGGGGTGCTCGG
GTCTTGGTTTTCCTTGTCCATGTTGTGTGGTTCAGACAGAGGCAATCGACGAGTGGCGATGTCTTCCGCATCGAACACCTATCACATGACCACGATCACA
CTTGGCATATGCTGAATAACCACACACCATTGCTTCTTTCATTGCATCACGAAATTCGGCGATGTTTCCTCGCTTTCG