Description :
From Genome Similarity Track
Location :
Scaffold_9:78613- 80127
Transcript NameFunction/comments
g5477.t1ETO81559.1 hypothetical protein F444_04180 [Phytophthora parasitica P1976

Sequence
1514 bases(100 bases per row)
TCCGGGTCAGATACCTTACGCAGCGTGTCGGTGATAGCGATGAAGTACGCGTGATACTCAATGTCCAAGGTCTCCAGTATCGTTGATTTGTCGTCAGCAG
CATCGGATAGCTGATCTGCTGCCTCGATAAAGGTCATGGCGCCCAGCTTACCATAGCTAAGCCCGGTCATCTCCTGAAGCTTGCGGATGCGAAAGTCGCG
AGGCAGCTTGCCTACGATAACACCGTCGGGAGATTTTACGGTGTCACCGTCCACAATGTCTGCGTTAAGTTCCGAGTCGGACGTCATGCTACGTCGATTC
CAGTTTGCGGAACCAATGGACAAGTACACGTCGTCGATGATCACAACTTTGGTGTGAATGAGAAGTTCCCGTTTTGCCTTGACTGTGTAGATCCTGAATT
TGGTCGGGTACTTCTCTCGGATAGGTGCAACCATTTCGTACAGATACTTGATGTACCCTCCTTTGCTAAACATGTTCGTTTGTGGGTTCACGATGACAAC
CAGGCGCTGAATTCTTGGCATCACCTCCATGATCGCATCTAGCAGCTCCGGAACGAGTATAAAGTACTGGTCCTCAATGTAGATGAAGTTTTTTGCGTTC
TTGATCGCCTTGATTCGTGCCTGAAACAGCGAATTTTCTCCGCGCGGCGCAAATTCTTTGTAATGTTCGTACTTGCAGCTGAAGGTTCGCGTGATCTGAA
CACTCTGGTTCCCTAAATTGGCGGTATCGCTGCTGCTAGTGTAATTCATTGCTGGGATATCTTCGTACGGCGGGTTGTCATAGTCGAGCAGGTCGTCTTC
AATACCCTGGCTGGGTAAATAGTCCGAGTTCCATCGAGCTAAGAAGTTGCTCGCGACATCCTTTGCGGCAGGCCCGTGAATTCGAACCTCGCCATCAATC
CAGCCCTTGTTCTTGTAGGTGATACCGCTCGCATCGCGAATCGCTGTAGCGTTATGATGTATAGTATCCCAACGATCGTTTGCAAGGTCAAGTCCACCCA
CGTATGTCACCGGCTGGCCATTGCCATCCGAGGACGATGCGATAACCATATTTTTCTGGTGGTGAGAGGCGAAGGCATTGGGAAGGCGATCGTCGAAGAT
GAACGTCGCTTTGGCTCCATTGATCGACGACGGGGGGATGCTGTTTATCACGTCGCGTGCTTTGATGTTGAAGGACTTGTATCCGATGTTCGACCAGTTC
AGGATGTTGACGTTCCCACCTCGCTTCACAACACCAGCAAATACTTTATCGACACCCGTCGTCGCCCCTGTCGGATCCACGTCCGGTTTCAGCGGTACAA
GGGCTGTTGTCCACCCAGTGAGCATGACCCGGTCACCCTCCTTGGTTTTGATCAGGTCGTCGTAAACTGCGTCGTAGAATTCCTTCGTTACTGTGTACGC
CGTCACAGCGTTGCCCGTTGTGTAGACGGCCATGTCACTGCGTGGCACTCCACCTCGTGAGTTGGTGATGTCCTGTTCGGTCAGAAACCAGTCCGTTGCA
TCGAGCAGCGGCTG