Description :
From Genome Similarity Track
Location :
Scaffold_517:7861- 15303
Transcript NameFunction/comments
Pytar_ATCC12531snap_masked-par_contig_517-abinit-gene-0.11ATP-binding Cassette (ABC) Superfamily
Pytar_ATCC12531maker-par_contig_517-snap-gene-0.5Conserved gene of unknown function
Pytar_ATCC12531maker-par_contig_517-snap-gene-0.6Conserved gene of unknown function
Pytar_ATCC12531snap_masked-par_contig_517-abinit-gene-0.14Calmodulin-binding transcription activator
Pytar_ATCC12531snap_masked-par_contig_517-abinit-gene-0.15Calmodulin-binding transcription activator

Sequence
7442 bases(100 bases per row)
CAGTAGCAAGTCGCGCTGGCTCAGTTCGTCTAGTCGGTTGGCCTCGGATAGTGACTGCAGCGCCATGTTCATCATGAGCCCGGGCATCGTGGTCTCGGTG
AAGTAGAACCGCGGCACACGCAGCTGCGTCATGAGCGAGAGCAGCGACAGCGGCGACGACCCCGTCGTGAGCAGCGGTAGCGTCGCGTTGAGCAGCTCCG
CCGGGGTCGCGTTGCCGGCACTGGCGAACGCGCCGCGCGAGAGCCCCGCGCCGGCCAGTGTCGAGTTGAAGTCGCGTAGCAGATTTGACTCGGCAAATAA
ATTCCAGTGGGAACCGGTCGTGTTGGCCGTGCCCATGGTCTTATTGGCGCTCGTCGTGGCCCAGCCGCCGGGAATGTCGAGATCCGGGTCGAGCGTCTTC
AGGAACGCGAACAGCAGAATGCACAGCAGCGGGTTCAGCAGTTCGCTGACTGTCGCGAACGGGTGGCGCTTCTTGACGATCCAGTTCTTGTGGAGCAGTG
CGCGCGCGATGCGGCCGCGGCTGCCGTCCAGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCAGCAATAGCTGGGAGGGACCGTAAGCCGCGAGCCGAAGCCGCGCGGTGG
CGAGCGAAGGATTATGCCATTTTGAGATGGAGAGGCACGCAAAGACCAACACTCTGCATTGGATCCCAACGGGCATAACCCAGATAACGTAACCCGAATA
AGAGCGAACCGGTCGTCATCCAATTCCGCACATGAAGGGATCAGGAAGCGAGAGGTATGTCTATGCGCTCGACGAAGGCTAGTTGCGTGCACTGTATTTT
GAGTCACTTGGTCGCCTTGGTGCTGCTGGTCGATGGTGTGGCGCCTTCGCGCTTGGCTTTTGCCGCCGCGATCTGCGAAGCACAAGTACCATCAGCTCGA
GCATGCGTCTAGAGTATGGAGGTATTATAATAGCTCCTCACCTTGGCGGCCATGGCCTCTTTGCGGGAGCCAAACTTGGCGTTCTTGTGGTGCACGCGCG
AGGCCTGTCCCGTCTCCGTCGTCGCTGCGATGGCCTGGCGCGCGGTCTCTTCGCAGGCCTCTTTCAGCCGCTGAGCAACGCGCTTGTGCTGCACGTCCGC
CATGCGCTATGTCGAGTCNNNNNNNNNNTACTATTCCATAACAGGGTATATTTTGTAAGCAGGCATCACCCACACATACGTAAAACCTACCGTAAACTGG
AANNNNNNNNNNCTTTCGCAAAGCTGTTCGTGTGACTACCAAGTAGTCACAAGATACTACACCATTTGTACCTCTTTAGGGTGAGCTTGTGCAGACTATT
CCATAACAGGGTACATTTTGTCTGCAGGCATCACCCACACATACCTAAAACCTACCGTAAACTGGAATTTTGGAGTCCTTCGAACCTTCGATGGAATGTC
CCTGGGGATCACTTCGCCCATCTCCTTCTGAATGACGGTCTGCATGCCATGGCGAGCGGGACACTACTGGTCGAAACAAAGTTGCTGTTTCTTCCTGCGA
TCCGTTCTGTGCCGTCTCGCGAGCGCGTCTGCCGCTGCGTTCCTTTCTGCGGATCCCCCTACTGAAGCCCCGCCTCCTGCGCGACTGCACATCTGGTTCT
TTTCCTTTCCAGCGGCAAGCTCCAGCGCGAGAGCGAGTGGCCGACAGAGCACCGCTCCGTGTATTCTCCGTTTTCCCGGCTTCCGACCATGGCGCCGGCG
CGACGAGCGACCTCAAATGTGGACGGTACGTGGCAATGGCAGTCGCTGGATATGGAAAGAGGACAGGGCGATGGGTTGACTCACCCGCTTGGATCCTTGC
CATCGATGTGTAGCCCCTGTCTGGAAGAGCTACGTTGCGGCACGCGTCGACCCCGGCTCTGTCGCCAAGGCGACTGCTATGACGACCCGCTCGCGCAAGC
GCGTCAAGCCAACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCACAGACACCGCTGTCCTATCAGCGA
ATAGCGCCGGCGCCACTGCCAAGCAGCAGGTTGCGACGCGCGCCAGTGTCCGCGCGTACTGGGAGTCGCTGACCGTCGCGGAGCGGCTCCAAATCCTCAT
GGTCGACGATCCTGATGTCGTCAAGCAGCTCTATAAGCTCAATCTGAGTCTGCTCTGCGTCGGGCTCATGCAACGCCACCTCAAGGCCGGAACGGCGCGG
GCCGCCACGGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCACAGGCACTACCTCCAGCAGTGCCGGTCCGTCGATCTCCCCGACGACACGACC
AGCGGCGGACGCTACCTCCTCCTCCTCTGCGAGTGACAGCGAACGCACGTACGATCTGCTGGAAGCGATGGAGTTCATGGACATTGGCACGGGCATTTTG
ACGGTCAAGACGGAGCTCGTGGAAGACGTGGACCACATGTTTGCACTCGTGACGGCCGTGCTGCATGGCTTCTTGACGACTCTCCACGTGCTCTCAGATG
GCCACTTCCGCGATCTCTTTGTCGCGGAAAGCGAGGTCATCAATACGTGGGAAGACTACGAGCGGCTGATCGCGATGCTCGTGGAGCAGCTCATGCTGCG
CAGTTACGTCGCGCACCTGGAAAAGCAGGCGACCCAGCAAATGGAGGCGTTGCTGCTCGAGGCGACTCGTGAGGAGGAAGAAAAGGGTGCGTTCCCGGCG
TCCGGTCTGCTGCCGTCTGCTGCAAAGAAGAAGAAGAAGAAGAAACTCAAGAAGAAGACTGCCAAGACGATTCGCTCAGTGAAAGTTGTGACGGAGCCCA
ACGACGTCAGCTCTGATTCTGAAAGCGAGCCGGGGGGGCAAGAGGAGAGCAATGCCGCTGTTGAGGATGCGTCCACGTGCCACAGTGAGTGCAGTACGGA
AGACGCCGACTTGTCCGGGCCGTCGAGTCCCGTGAAATCTGTCACGAAGACGTTGAACCGACTCAACCCGCATGCACCAGCATTCGAGCCGACACTGCTG
GGGACTCCATCCATCGAGGAGCTACGCAGCCCCATTTCTGGAAAGCGCAAGCTCGACGATTTCATCATCCACATCCCGTGGCAGGACTTTGTCCATGGTG
TTGATGAGGACGAGGAAATAGACACGGCAGTGGAGACGATCGCAGGCGAGCTGGGTTGCCGCCGACCGCAGGACAAGTACCGACGCCGAGACGATGATGC
TGAACTGGAGTGGCATCTCCAGCACATGTACGCGTCGACAGCGTCTCTCCTGGGCTGGGACTTTAACGAGCAACGCGAGATTAAAGCAGTGATGCCGTCG
GGTCCGTGGATGGACGCGTCGCTCTGGCGCACAGATCCGCGTGAAGTCGTCCGCTACTACTTCCCACCGACCGGTTTCCCCAGTGGTGGTTTCCCACCGG
CTACGCCACCGTCACGATATTACTTCACCCCACCACGCCACACGCCTCTCACATCGACAGCAACCGACCCTTCATCTCCTCACGCAGCGGCTGTGGGCGC
CTCCGTCTTTCTGGCTCCGCTCATGCCTCCTTCAAGCGGCCCGCCCGTATCTTTCTGGGACGACCACGCGACTCTCAATGCCGCGTATCCGCCAGTGGTG
GAGCCACAGCCGTTCCCGAAATTCCGCCCCACCAACTCTTTGCCTCGGCGAAGGAGACCATCGGAGCAAAGCTAGCGAAGCCGTAGCTTCTCATCCTGCC
TGTCTAAAGCTGCCTACTGATATATGCCATTAGCAGCCCAATCGAACTTAAGATAAACTTCATCGTACTTAGTGCACCATCATTTTGTGTCCTTTTGATT
GGCTAATATTTACCACCGGTCTCTTGTGTGGGTGGGATCGATTCGCGGCGAGCAGCTCCCTAAACAATGGCGACGACGATCGCGATGGCGGCGCGCAGCG
CGCTCGTGTTGAGCCAGAAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCTCGCGACGCGCGGCTTCGCGACACCCGGCAAGAAAAAGGC
CTCGAAGAAGAAGAGCAAGAAGAACCCCGAGGACGCCAACTTTGAGCTTATGCTGCGCACGGTGCGCGGCCGCTACCCCGAGACGTGCGTTTTTCTTCTG
ATGGATCTTGCTCTACGCGCATGGCAAGCGTAGTACGTACTGATGGTGGTGGTGGTGGTGGTGGTGTATGATAGTGAACCGTTCACAGAGGAAGACAAGC
AGCGCTTCCAGGAGATTGGCCGCCGCTACAACCAGATGAGCACGATCCGACACAACCACTACATGCGCGACCTGCAGACCAAGATCGACCTCAAGTGGGC
CGCGATCAACGCGCTGCCGGCCGAGCTGCAGCAAGAGGCGCTCGAAATCGACGACGCGTCCGTGCCCGAGGAGCGCGGCTTTGCGACGTGGACGCCGCCC
ATTGAAGGCTTCTACCGGTACTCGGGCGAGGATGGCGACGAGTACGACGACATGTAGACGCGAGCGGCACTAGTACAGCAGTAGAAAGCGGAGGCATCTC
CACGCAGGAAGGAAGATAAAACGAGACAAAATCCAGAGATGAGATGCCAATGCAACTAATGCTCTTCTTCTCGGGATGGGGGGATAAATACAAACGAGAC
CGAGAAGAGATCCCGCACGTTCCAAGCTCACGGGTGGCCAAACGACGCCATCGGCGGCGCCTCAAGCACGGCGTGGAGTTCACGCACCAGCGCGGCATCG
GACTCGGACTCGTCCTCGTTCATGTTGTTCTTGGGTGGAAGCACCGACAGCGTCGGCGACCGCGACGCCATCGCGGGGGTCCCAAATGCACTCGTCGCAT
CTGTCGAGGTCGCTGAGTCGTCTCCACTGCTGGCAGTAGGATTCTTGGAGAGCCATTCGCGAACGTTCCGCTGGATCACGAGCGACGCGAGCGCGTGGGT
CTTCATGCGCGCAAAGTGTTTGCGGCACAAGACGCCGCGCGTCGCGGCCTGCACCTTGATCGTGACGTTCCGTGTCTGCAAAAAGCTCTTGCGTGCAAGC
ATCGTACGCGCGGCGGCTTGCACTGTCACGGCCGCACGCTCGCGTTCCGACAGTGCCTGCTGGGACGTAAGCGTGAGAGGGTTATTGGCGCGGTGCTCAT
TTTCCTGCTGCTGCTTTTGCTGGTCCTCAATGCTCTTGGCTGCTTCGTGGAGTTTCTTGGTCGTCTCACGCATGTTACGACAGTTGCGGCGAAGCAGCCA
CGCACGCACGTTGTTTTGGATCACACGCGCTTCTTCCTCGAGCGACTGGATCTCCTCTGGCCCCATCAACTCCATCGCGGCTTCGAGCTTGTTGAGGTTC
TCTTCGTCGTCGGCGATCACGCTCTTGACATCCGTATCACGCATGGATTCGCCTCCCTCGCCCGCCGTGATGCCGTGGTTCGAATTGCTCACGTTCGTAC
CGAGCAAGTCGGTGCCCTTGGAAGGGGAGGACGCAGACGTGGACCCGCTGGTCGGCATCAACCCAGCGATGCTTTCTTCGCTGAAGCTGCTCCCGCGGCG
TTTCGATGCCGTCGTCTGGGAATTCGACGACGGCGCCAAGTCCCGTGAAATGCTCAGCGACAAGGCGCACTTATCGTGGAGACTCATGGTCGAAAACGCC
CCGAGGAGGAGCTTGCGATTGTGTTCCTGATTCTCGCCCACCTACAACGCATTTGTGTGTGAGCCAGTGTATCCATGAACCACATGACACTGCAGATGTC
ACTTACATAAGATGTCGTTCGGGACGTGGACGGCAACGCGTGACCGTGAGGATCCACACCGCCATCCATGTCCGTATCCAGGCCTGGCGACTCTGCAGCG
AATCGCTCTTGCGAACTCTGTGAGTGACTGCTGAAGCCTCCGCCATCCGTTTCCACGTCCATCTCGCCCATCGCATCGGCCCACATGCCATGGCTCGCAA
TCTCAGACTCCAATGATGCGCCTCCCTGCATGAAAGCACTACTCATCTCGCCCATGCACTGGCGTAGCCGCTGCGCCATTTCCACGTGGCCAGACTTTTC
TGCGCGTTCGGCGGGCGTGAAGCCGTCAAAGTCGAGTGCAAACACATCGGCGCCGGCTTCCAGCAGCTTGTCAATGACTTGGGCATAGCCGCAGCCAGCC
GCGAGATGCAGCGGTGTCTGTCCCTGCGTGCTTTGCTGGTTGACCTGGGCCCCGTGGGAGAGCAGCAGCGGGATCAAGTGCGCGTAGTTGTAAAAGCTCA
CATAGTGGAGCAGACTAAGACCCGTCTCGTCAAGCGAATTGAGTTCGTCGAGCAATTCTTCGCTCGTGTGTGCGACAGTCACGAGCTGCCGCACGACGTT
CTCGATGAGCTGTTCGGATAATGATTCGAGGGCTTGGTCGCTCAGCGCTTCGATGGCACCGTCATCTAGTGGGGCAGGCATAGACGTGGTCGAGTCGGCT
GCTGAACTAGTCTCTTGTGAGGTCATCGGGGAGCGACCACTAAGAGTCGACGGCTCGAGCTCGGGTTGTCGGCTAAGAGGGTCCTGCGTAATTGAGCTGG
TCGACGTCGTTCGAATTGCGTCCTGAAACTCGGCGAGGCGTTCAACGACTCGAATCTTGCACTGCCGTTCATCCACTACAGCATCACAAAGCATCAGCTA
GAGTCCATGGTCTTCAAAAGATAGAAATGGGAAAGAATCGCACAGCCAGTGTCGACAAAAGCCGAGAGATTGCTGCCGTCAGGGTTGCTCCCGCGCCGTC
CATCCGACAGTTTCGAATCCGTGCTGCTTCCTTGTTGGCTAACGCGTCCGGCCGATCCTCCCGCTGGCGATCGGCCTCGCTTCCCGGCACTCGTTGTTCC
ATACGTTTGCAAGTCGGGCAGCGAGTCGACTTGCAGCATCACTTCATCGCTTCCAACCATTGGGGCTGGCGCTGGGGACGCCGTGATGCTTCGGTACTCG
AACCGACCGGTCGTGGACAGCTGCACGCAATCAGATGCCGTTGCCGACGAACAGCGGCACACGAAGAGTTCGACACGGCCATCGCACAATGCGGGCGGAG
CTACAGCAACACATTACCGTGAGAAAGTGGCCCAAAGGAGAACCTACCGAAGGACACGGGCGACGAACCTGCACAGCGAAGCACCGTGTCAGAAATTCGC
TCCGCGGGAGACCGCGCGTGGGCGCCAAACTGTACAAAGACGTTGTCGGCCGTCACGAAGGGTAGTGGCGTCGCGAGACAGATCAAGATCTTGGCACCAC
CATGAATAAAGTCCCACCCAGGCGAGAAGTCTGAGATCGCCACAAGGGGCGGCGCTGCCGGAGGCGAGGGGCTCGTTGTACCAATGAGCTCATGGGGAGC
TGATGAAGTCGACTCGGGCGGCAATAGACTCGTCAACTCGGA