Description :
From Genome Similarity Track
Location :
Scaffold_1148:7861- 8864
Transcript NameFunction/comments
Phypl_g12563hypothetical protein

Sequence
1003 bases(100 bases per row)
agaggaagccgagAACGGGTGGGCCAAAGCCTGGCGACGTCAAGACGAGTTTCCTCATCCGGACGCTGCCGAGGGAATGCAACCCGACGCCGGTTCCTAC
CGGCGGCTTGAGTGCGAGTGCGTCGGGGCTGCTGTCTCCATTGGGGAACAGAGCCGGCGGGAAGCAAGATGCAGAGCTAGAGATTCTGCAGCTGGATAAC
CCATTCGACGACATCACAGAAGAAAAGCTGGTGAGTTGGAACCCCCATGGTGCTTTTAGTGTGAATAATCCTCGTTTGACAATTCGTTTTGTGTTttggt
gttggtgctgcagaaaAAACTGACAGGAAGTCAAGACCTGGAGCGGGTTACTTCGCTGCAGATCTCGGTCGACTCAACGAAGCAGTCAGTGGAGGTTATT
GGGGAGCTATTGCCGTCCCTACAGCagctgcgactgcagcagagcagtCTGAGCAGTTTTCGGGATCTGGGCACATCGCTGCGACCACTGCGCATTCTCT
GGGCAATGCACTGCCACATATCCGATCTTGACGGCATCGGAGCGCTACTGAACTTGCAGGAACTGTACCTGCAACACAACAATGTGAGCGATATTAGTCC
CTTAACGATGCACGAAGAACTTCGCGTCGTTGGTAAGAAGCAGAATCGTGATATGAACGTGGTATCGGGGGCTCACTATGCTATGAACGCAGATTTGGAA
GGGAATCGAGTCGCAGACATCGGCCAGGTCGAGCAACTTGGTAAGCTTTGGCCCAGCTACCGCATGCATTAAAAAATACCGTCAATACTTACaacttctt
gctgttgtcaGCTTTTTGTCCGCAGCTGACGTTACTCAATTTGACGGGAAACCCTGTTGAGACGGTCGAGCACTACCGACAAATTGTTGCCAACTTTGTG
CCTCAACTCATGTCGTTGGACGACAGAGCGTTTCCAGACAGCGAGCTAGTCAAACTTTCGGACTTGGAAATTGACGCTGCCATCCAGAAACACCGAGACC
AGC