Description :
From Genome Similarity Track
Location :
Scaffold_835:786- 5013
Sequence
4227 bases(100 bases per row)
TCCTCCGGATGCTAGATATCTGTTATACTATGCTAGTATCCCGTGAGATTACGGTGCTTACGCGATATTCGACACTAGCATCGTTACTACCATCTTCAGG
CCTAAACGGAACATTGGGAAGATGGGCTGCTTTACTACCGACTGGACGTTGGAAATTAGGCGATCTGAGAAGGGAGAAGATGAAATACTCGGCATGCTTG
CGGCAAGTATAACACCTCGTGAAGAAGTAGATGAAGTATTGATTGCGATGGCCCCGCGGAAGCAGCCAAGACAGGCGATAAGCATGCCACCACCCACAGT
AGGTGTGAATGAAAACCTGCTGGTAGCCAGTTTCGATGGATCAGCCAGGGTGAAAAGAAAGGGCGGAGCATACAGCGCGATTATATGGAAACTGCCGGAA
TAGACGATTGTGGCTGCTGCTTCCGAGTATACCCCTGATCTAACCGTGAATGAAGCAGAATACCGAGGGCTGCTCCTTAGTTTTGATTTGCTTGCCGATC
AGGCAAGGGGACGGGTAATTATCTGCGGAGATTCGAATTTGGTGATCCGTCAAATGCGAAGAGAAATCGACTGTAAAGCGCCGGGACTGCAGTTGTTGAG
GCATAGGGCTATGGAGAGATTACAATCGTGGCCATCCCAAGAGTTCTTGCACTTGAAGCGGGACTGGAATCAGAGTGCAGATCGATTGGCGAGTGAAGCT
CTACGGCAAGAGAAAGGGACAGTTGTGGTTTCCGATCAAGAGCGTCAGGACCTGATTACTCTCAATCGGTTGAACGAATTACTACTACCAGAACGAGTTG
ATCGTGCGGTCAAATCAGCGGCTATCACTCGAACAGCCCAGAGAAGACGATGTCAGCCCAGGATTTTACAGGAAGAGGTTGTGCAGCAGAAACGGATTGG
TCGTATTAAGCAAGCACAAGGCGAAGAAAACTGGACATCTAGTTTGGAGATATATCTGGTTGGAGACGTAGCTAATTTATCGGCAGCTGAGCTAAGTGTG
CACCCTGATCGCACCGGACTATGGAGTAGACCAACGTAGGCTGCTATTCTTCTGTCCAAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCACCCTAGCCTCGACGGGGAATGTAGAAACATGGCGTCCAGTAAATTCGAACGGGGAAA
GTGTAGAAACATGGCGTCCAGTAAAATGTCCAAATCGCAGAGCCGTCGATCATGCCTTGAGAATCAGCTACAGTACCCGCTTTCAACGGGGGCCAGCACA
AGATCTTCTCTGCCTTCTCGCTCGCGCAAAAGCGGCCAATTCAGGATCCGTTTTACGCTGCTCAACGGAGTTCCACAAGAAATGGGTCGATTCCCACAGA
GCTTGGCGATGGCTATCCACGAAACCTTCATACGCCTTGACCAGTTTTTCGAACCAGCCGGAAGGCTTGAAGGAGATCGGTTGTATGGTTTGATCATAAA
GGTCCCCAGGTTGTTGATCGTAAAATTGGTCAATCTTGGTCGACGTGGTCAACTGGGATGACCAGGACGACTCCGGATGAGGGCGAACTTTGCCCAGATG
GACCGGGAAGATGTATCCGTTAGGCTTTGAAAAGTGATGATATAACAAGTCTATGTCCAGCTCCGATACGCTAATCAGGCTCACTCTTCGGGTGGATCTT
GATCCAAGGGGACACATCTACTGCCGATCGCCGAACCCGATCTCGATACCCCGGAATCCAACGATTGTGGGGTATGCAGCTGTCAGGAAGTGCCAAAAAC
TCTTCAGGAGTGAGCAGTGGATTGCCGGGACTCCGAGAATCACCAGAGAGGCTGAAGTCACCTTTAGAGTCGCTTGAAGGCTCTCTAAATAAATCCATCA
TGGATATTCGCGAGGGACTACCGTGAG