Description :
From Genome Similarity Track
Location :
contig_16:785903- 787510
Transcript NameFunction/comments
g4545.t1POM66637.1 Major Facilitator Superfamily (MFS) [Phytophthora palmivora var. palmivora

Sequence
1607 bases(100 bases per row)
CCATCGCACTCTAGTGAGAGACGCTCACTTTGGCATTTGCTCACGACTCCAGACGCACAACCAAGTTTGACTGATGGCGCCGCACGAGTCTCCTCGCAAC
GGATACGCCGTCGTCCAGACGCCACCGGCCGTCCCCCACGACGACGGATTCCTGCTCAACATCGAGGAGCGGTCGCTCCGGCCGACGTGGATCGTGTACT
CGTCTGTGGCCATCGCCATGCTCGAGGCCTTCCACTACGGCTGGTCCAACTCGCAGGTCAACCTCAGCACCTTCAGCAACACGGATGACTGCAACGCGCG
ACCGGTCGAGGACGGCACGTGCCTCATGTTCCCGGGCCACACCAAGACGACGTGGACGCTCTTGGTCAACGCGTGGATCGTGGGCGGCATGTTCGGCAGT
CTGCTGTCGGGGTTCCCGTCCAACAAGTGGGGGCGTCGCACGACGCTGCGCTTCAACGCGATCCTCATGGTGCTGGGCTCGGTGGTCCAAGTGGTGGCCA
ACAACCCGACGTGGTTCGCGGCGGGCCGCTTCGTGACGGGCGTGGCGAACGGCGTGGCTATGGCCGTGGTGAACACGTTCCTGAACGAGATCTCGACGCC
GCACAACCGCCACGCGCTGGGCACCAACACGCACTTGGCCGCGACGCTCGGCATCTTCGGTGTGGCCACGACGTTCTGGTACTGGAACACGACGTCGGGT
TTCCGTTGGATCGCTGGTATGCCGATCGTGTTCGCTGCTGCGTTCGTGGTCATGTCGTTCTTCTTCATGGTGGAGAGTCCAGTGTGGCTGGTTGCGAATG
GGAAGGATGAAGAGGCTGAAAAGGAACTGGGTAGGCTGTACGGCAAGGAGAACGTCAACGTTATGATGGGCTGGATCCAGTCGAACGACCGCAGGTCCAA
GCTGCCGTCCATGCTGAGCGGTGCGTCCGACAAGGTCAACACGGAAACCAACTGGACGATCCTGACCAACAAAAAGTTCCGCAAGCCGCTGATCATCGCG
CTGGGACTGACGTGCATCAACCAGTTGGTGGGTATTAATGCTGTGTTCTTCTACTCGTCGTCGATCCTCAAGGACGCTGGCATCTCCGATTCCCGTGTTG
GTCTCATGATCATCGACATCCTGAACGTCGTTCCCGTGCCGATCGCTGCTGCGTTGACGAAGATCATGCGTAAGCGCACGATGCTAATCTCCGGTATTTC
TCTCATGGTGCTGTGCTGCATTGGCATGACGTTCTCGCTGGTGTACAGCGTCGGCTGGCTGTCTATTGTGTTTCTCGGTCTCTTCGTGGTGGGCTACGAT
CTGAGCATTGGCCCTCTTCTCTGGCCGATTGTCGCTGAATTGTTCGCGGACTCGGCCCGCGGTGCTGCTGTGGGTATCTGCATCACGATGAAGTGGATCT
GCTCCCTCATCGTGGGCGTCGGCTTCCCGTACGTCGAGGAGGCGATCACGAACTACAGCTTCACGCCGTTCCTGGCATCGACACTACTGTCGATCACCTT
CATCTACTTCATGGTGCCCGAGACGTCCGACATGACCATCGCTGAGATTCAGGACGGCTTCCGAAGCGACCGTAGTGTGCAGTCGTCGAGCAAGAGCCAA
GTGTAGG