Description :
From Genome Similarity Track
Location :
Scaffold_70:78588- 79595
Transcript NameFunction/comments
Physo_139079elicitin-like protein SOL7

Sequence
1007 bases(100 bases per row)
CATTGCCCGTTACCGACGAAGACTTGGTTGGAGAGAGTGTGCAGCGATATTGTTGTTGTAATTCATCCTTGAGCGGCTCCTGAATCATACTACGTAGAGC
TGTTTGTTGCCAACTTGGCAATGCCAAGATGAAATGCTGCAACGGCGGAAGTGTCGCGTTGCTCTCCTCTTCGTAGTGGATGGTCTCAAGTGAACTCAGA
ATCAGTTTAACTTCAAGATTGTGCGGGAGGTCAGCAAGCGCACGCCGTGCTTTACGCTGTGCCACGGTTGTCACTCAAAGGATCGCGTTGGGCGGACTTA
CAGAGTCTGTGAGTCACAAACAATGCTCGTCTGAACACCATCATTGTTGAAGCCGACACAAAGTGTGCCACGATCGAGTCGATGACAGCCACGATTGCCA
TTTCGACCTCCAGCTTCCTGCTGTCTGCCCCTAGAGCGTTCAACGTCGACACTGTTTGCTGTTTGACGCGAGCTATCCGCTCTTCTCCTGCTCTCTCATG
GCAGTAAACAGCTCCGGTTCAAGGCTCGACCAGGAGTTCATTATTCAATCTTCCTCCAAGCTCCAACACCAGCTTCCCCGCCCCCACTCCCCTCCTCTTC
CAAGAACATGAAGACCTTCGCCTACGCCGCTGCCGCCGCCGTCGCCTGCCTCGCCACGCAGACCGCCGCCTACGACGAGACCACCGTGTGCCCGTCCTCG
GAGACTGCCAAGCTCCTGGCCCTTGCCGCGGACCCGTACCTGTCTTCGTGCCAGACCGCGTCGGGCTACACGTTCGTCCCGCCCTCGGCTTACCCCACGG
AGGCTCAAGTCCTGCTCATGTGCCTAACGTCGGACTGCTACTCGCTCATCTCTGACCTTCTGGCCCTCGACCCGTCGGACTGCGTGATCGACTTCGGCAC
GGTGAAGATCAACGTACTGGAGCTGGCGGACAGCTTCCTGCCCAACTGCACCGCTCTCGGTTTCTCGGCTTAAGCGACGAGCAGCTCGCTACGCAAAAAC
TACGAGT