Description :
From Genome Similarity Track
Location :
Scaffold_330:7858- 8989
Transcript NameFunction/comments
Phypl_g7058hypothetical protein PHYSODRAFT_484094

Sequence
1131 bases(100 bases per row)
AGTGACAGTGAATACCCTAATCGTAGCCTTTTGTAGCCATTCCGTAAGATCCATCTACCGTCATTTCGGTTCGATACAAACAAACAAGGATGGACGTGTG
GGGCAGCCAGAACGCAGCGGCTAGCGAGCAGCCGCCtggggaggaggaggactGGGAGCTCGCCGAGAGCGGGAAGGATGCGctgatcgtgctgctggat
gtgcgCAAGGTCATGTTCTCTCCGTACCCGCACGCGGCAGCGGGGGCGCCATCCACGTGGTTTCACGCCGTCGTAGAGTTCGTGATCAAGCTTCTCAAAT
CAAAAGTGGTCGCGAGCGACAACTCCCTGCTAagcctcgtcttcttcgggACGGTGGGTGGAtggttgcgctgctgctggtgtctTCATTTTGTTTTGCC
AGTTCGGCTCTAACCGACGGTTTGAACCCAGAACAAGCGCGGGGAGGCAGGTTCGCTGGAGCAAGTCTACGAGTTTCAACCGCTGGGATACCCATCAGCA
CAGCGGATCAAAGACCTTCAGGCTCGTTTAGATTGCCATTTCTGCCTCCGCCCTCTTGGTTGCCAACTCGGTGGCCCCATTTCATTATTAACGTTATGCG
TTGTAGGCTCTGCTGGAGACAGACGCGCAGTCGGAATTTGAGTCCATGCAAAACGCGGAGAAACTATCATTTAGCAACGCGTTGTGGCAATGTggcatct
ccttctccaacgcAAAGTACGTAATTAAAGTAGCACTACAACTAGTGTGTTCTGTATTTTATCTCGTCGTGACTGCACTCGtagcttgaagaagaaggac
tCGCAGCGCATCTGGATATTCACTGACGATGACAATCCAGAGGGCCCAGACGCAGAAGAAGTTGGACGAATTCAGAAGCAAGTCCAGGTAACCAGTCGCG
CTGCGTTTGTCTAGAACATGCAGTTTTGTTTGACATCTTCAAACTTATTCGTTTGAGACAGAACCATACCGAGTTAAAGCGCACGCTGAACCTGTTCTAC
ATCACGCCTCCAGGGAAGGAGAGCTTTGATCTAGCAAAATTGTACGGGTGCAGCTTTAAGGACTTTTCagctgatgaagacgaagaaatGATTGAGAGCG
ATGCATCTTTCCAGCCGGCATTTCCCGTCGG