Description :
From Genome Similarity Track
Location :
contig_16:785788- 787395
Transcript NameFunction/comments
g4343.t1hypothetical protein

Sequence
1607 bases(100 bases per row)
CCATCGCACTCTAGTGAGAGACGCTCACTTTGGCATTTGCTCACGACTCCAGACGCACAACCAAGTTTGACTGATGGCGCCGCACGAGTCTCCTCGCAAC
GGATACGCCGTCGTCCAGACGCCACCGGCCGTCCCCCACGACGACGGATTCCTGCTCAACATTGAGGAGCGGTCGCTCCGGCCGACGTGGATCGTGTACT
CGTCCGTGGCCATCGCCATGCTCGAGGCTTTCCACTACGGCTGGTCCAACTCGCAGGTCAACCTCAGCACCTTCAGCAACACGGATGACTGCAACGCGCG
ACCGGTCGAGGACGGCACGTGCCTCATGTTCCCGGGCCACACCAAGACGACGTGGACGCTCTTGGTCAACGCGTGGATCGTGGGCGGCATGTTCGGCAGT
CTGCTGTCGGGGTTCCCGTCCAACAAGTGGGGGCGTCGCACGACGCTGCGCTTCAACGCGATCCTCATGGTGCTGGGCTCGGTGGTCCAAGTGGTGGCCA
ACAACCCGACGTGGTTCGCGGCGGGCCGCTTCGTGACGGGCGTGGCGAACGGCGTGGCTATGGCCGTGGTGAACACGTTCCTGAACGAGATCTCGACGCC
GCACAACCGCCACGCGCTGGGCACCAACACGCACTTGGCCGCGACGCTCGGCATCTTCGGTGTGGCCACGACGTTCTGGTACTGGAACACGACGTCGGGT
TTCCGTTGGATCGCTGGTATGCCGATCGTGTTCGCTGCTGCGTTCGTGGTCATGTCGTTCTTCTTCATGGTGGAGAGTCCAGTGTGGCTGGTTGCGAATG
GGAAGGATGAAGAGGCTGAAAAGGAACTGGGTAGGCTGTACGGCAAGGAGAACGTCAACGTTATGATGGGCTGGATCCAGTCGAACGACCGCAGGTCCAA
GCTGCCGTCCATGCTGAGCGGTGCGTCCGACAAGGTCAACACGGAAACCAACTGGACGATCCTGACCAACAAAAAGTTCCGCAAGCCGCTGATCATCGCG
CTGGGATTGACGTGCATCAACCAGTTGGTGGGTATTAATGCTGTGTTCTTCTACTCGTCGTCGATCCTCAAGGACGCTGGCATCTCCGATTCCCGTGTTG
GTCTCATGATCATCGACATCCTGAACGTCGTTCCCGTGCCGATCGCCGCTGCGTTGACGAAGATCATGCGTAAGCGCACGATGCTAATCTCCGGTATTTC
TCTCATGGTGCTGTGCTGCATTGGCATGACGTTCTCGCTGGTGTACAGCGTCGGCTGGCTGTCTATTGTGTTTCTCGGTCTCTTCGTGGTGGGCTACGAT
CTGAGCATTGGCCCTCTTCTCTGGCCGATTGTCGCTGAATTGTTCGCGGACTCGGCCCGCGGTGCTGCTGTGGGTATCTGCATCACGATGAAGTGGATCT
GCTCCCTCATCGTGGGCGTCGGCTTCCCGTACGTCGAGGAGGCGATCACGAACTACAGCTTCACGCCGTTCCTGGCATCGACACTACTGTCGATCACCTT
CATCTACTTCATGGTGCCCGAGACGTCCGACATGACCATCGCTGAGATTCAGGACGGCTTCCGAAGCGACCGTAGTGTGCAGTCGTCGAGCAAGAGCCAA
GTGTAGG