Description :
From Genome Similarity Track
Location :
Scaffold_471:7853- 12905
Transcript NameFunction/comments
g14683.t1hypothetical protein
g14684.t1ABG66536.1 reverse transcriptase, partial [Phytophthora ramorum

Sequence
5052 bases(100 bases per row)
CCCACGCCTTCCCCATAAGTTCTGCGCTTCGGAACTCGGATCCGTTCTTGGCCGCCTTCTGGGAAGAGCGACGTCAGCGGCGATCTCGTCTTGGTGCCCG
CTGGAAATCGTTATTACGACACGTTCTCCGCGGGATGATCGACGGTCATTGCGATCTAGATCTGCTCCTCGACCCCTTTTTCCTGCATTTTCCCCGGCTC
GGCGAGAAAAGAGTATGGTATCCCGGCTTGGGATGTTCCCCACGACCCTCGACCTTGGTCGAGGCTCTTCGCGCGATTGACTTGGAGGAGCCGTGGCGTA
ACCAGTACCGCGACAACCTTCCAGATCACCCTGGTTCTCGCCTTCCGCGTCTTGCCGCCAAATTTTGTCGCCCAACGACCGGGAATTAGGAAATCGCAAT
TAGCTATCCCGTAACCCTTTAACAAGATCACATGATCTCATTCATCTCGGCTTCTGCGTTATTTCTTCATCGATCTTCCTTGCTTATGAAGCTCTGGGTG
CCACCTTGAAACATGGTAGCTTCGCCCCAGGCCATACGTCACTCCACAAATAACCCTTCCTCCTCAATGTGCGGCCTCCCCGCACATTTTTCTCCACATC
TTCCGCCCGCAACAGCCAACCTGCTACGAGCCCTCCTCCTCCGCCTCATGCGACTGCATGACTCCGAATCGGTTGCGGTTAGTTACCTCACGTTCATACT
CACGCAACAATGCTCCGCAGTTGAGGTCGGCCTCGTCGACCCATGATGGATCTTCGTAGCCCTTCCAGTACACTTGGAACTCTCGATGAACTCGCCCATA
GCGCGTACGCCGCCCTGATCGCACATCCACAATCTTGTCAACCTCGTATTCGTCTTCGCCAAGGCTGCGTTCCCAACTATCTTCTGGCAGGATTGCTTCG
TCAAAATCGAAACGATCGCCTTCAACCACGGTAAGTGCCAACGTAGGGCGATCGGGAAAACTTCGCACCAGCTTGAGCTTAGACACGTGGACGATCGGAA
ATAAGCGGTACTCCGTGCCAGCAGTCTCCAGTCTCGCTGCGTGATTACCTATCATCTCGACTACCCGGAACGGGCCGTGCCACATATGCGCCAGTTTTCT
CGCGTAGCCTTCCTTCACCCGGTCCAGATACAGCCAGACTTGTGCACCAGCCTCAATCTCCTGGGATCGGACGTTCTGGTTGTGCTCGTCGGCTCGCGAC
TGGATCGCTTCCCGGAGCCGCTCATTTACCTGCTCCCTTGCGCGTCGATATTGACTTTGCATGTGGAATCGCCATCGTCTTGGCTCGCGATCACGTCGGC
GCGTGCTCCCGACGGGTAGCGCCGCTTCCAACGTGGATCGTGGGTCCCATCCGTGGATCAGATAGAACGGTGTGTCTCCACGCACACGATCGTGGGCCGT
GTTGATTGCGAATGTGAGGCGTTCTGCGTACTCGTCCCAGTCCTGTTGGTTAACGTCTGCGACGTACATCTTCAATGCTCGAGTCAACGTCTGCACCATA
CGCTCGGCTGTTCCGTTTGCCTGGGGCCGGTACGCCATCGTGGCTCTCTGTTTTTGTCCCACGATCCGGCTGAATGCACGGAAGAAATCAGACATAAAAC
CGGGTTCTCTGTCGTGCCGGATGGCTTCACTGGCTCCAAAACGGCGGAATACACACTCTTCATAATTCTCCGCGATCGTCTGGGCCGTCCTTGACGCACT
TGCTTTCGCGATCACATATCCCGAGAACAGGTCTACCCAGATCAGCAGCTCCGTGTTGCCCTTGAAGGACTTGGGCAGCGACGGAATGTGATCCATCGCG
ACAATCTGGAACGGGTACGTCGCTTGCAAGTTTCCGGGGGACTCTCCTCTCACGAAGGGTCGTCCTTTCCCTGTCTCACAGTCTGTGCACTCTCCCACGT
AGCGTTGGACACTTCGGTACAGGCCTCTCCAGTGAAAATGCGATCGGATTCGTCGGTACGTTCTTCCGATCCCCTGATGCCCTCCTTCCAGACTCGCATG
ATAGTGATGTAAAAAATCTTGCTGCAGAGTCTCTGGGACCACCAACTTTGCGATCTCATCCCGATCCTCGTCCTGCGTCATGGATGATGGACAATAGAGC
AACAAGTCGCTCTCGTCCAGCTCGTAATCGTCCGCGATCTTCGCACACGACTTGGCTTCCTTCGCAGTCAAGCTACCGACGTCTCCCTTCAGGTACGCCT
TTAGGTCGGTGATCCATTTCTCCTCATTCTGGGCTTGGACGACTCGCTTACTTCGCATGCGCTGAATGATCGTTTCCTGCAGAGCCTCGGGCGGCAATCG
CCGGCGCCTCGTTGATCTAGTCACCGCGGACACCCGGACAATACTGTCGTCATCCTTCGGCTTGAGAAGCTCATCCAGACGGTTAAGTGTGACCAAGTCC
TGCCGATCACCCTCTGAGGTAATCACAGTTCCTTCTTCTCGTTGGAGAGCGATGCTCGCTAACTTGTCTGCACTCTGATTCCAGTCTCGCTTCATGTGCA
GGAACTCGTGTTTCGGCCACGATCTGAGCCGTTCCATTGCCTTTTGGCGCAACAGCAACAGGCCTGGAGCTTTACACGCGATCTCACCACGCATCTGGCG
GATCACCAGGTTGGAATCACGGCAGATCACGATCCCCCCCGGTCCAAAGTCGATAGCAGATCAAAACACAACAACAACCCGCGGTACTCAGCTTCGTTCA
CGGTCAGATCGGGCATGTACTCCGACGCGGCTGACAAAATCGTCCACTCGGGGAGCTTCCATATGATCGCGCTGTAAGCCCCACCGCTACGTTTAACACG
TGCTGATCCATCGAAGCTCGCGACTAACAAATTCTCGCCTGCTTCAACCGTAGGGGGTGGCATGAGGATCGTTTGTCGAGGCTGTTTCACCGGCGCAATC
GCGATCAGCGCTTCGTCTACTTCAGCGCGAGGTGTGATGCTTGCTGCAATCGCACCCAGGATTTCATCTTCCCCTTTCGTGCATTTCCGGATCTCTAACG
TCCACTCTGAGAGCAGCGCAGCCCAGTTGCCGAGTCTTCCCTGGAAACCGGCTGAGTTGACTAGCCAAGCCAACGTCGAGTGCCTGGACAACACCAAGAT
CGATCTCGTCGTCAGCAAGGTGTAATTCACGTCCAGCATCCGTAAAAGCGCCAAGACTTCCTTGTCGACGATTCCGTAGTTGAGCTCGTTGGACTTCAAA
GTACGACTGGTGAAAGTTACTGGCCAGTACACGCCATCATGCTCTTGCACAAGCGCCGCGGAGATCGCCCATTGACTCGCGTATACCACGATCACTGGAG
TGCGATCGGGATCGAAATGTCTTAGGATCGGTGTGGACACGATTTTGGCCTTCAGCATTGTGAACGCGATCTTCGCTCGGGTCCAACGATCAGCGTCCGG
AATCTGTGGATCGTCGCCCCCAGTCATCTTTTGGCCAGGGTTGATCCTCTCTAGGCGGCTGATCTCATGAAAGTCCACTTCGCGCAGCTCGTACAAGACG
GCGGCGTAGATCGCAAAGTCTTCAATGAAGCGACTGTAGTAGTTCAAGCTTCCAAGGAACGACTGCATCGATCGCAGCATCAGCGGGAAGGGGAGATTAC
TCAGCGCCTCAAGGTCTTTCGGGTGAGCTTCCAAACCCTCAGCAGACACCTGATGGCCCAAGTAACCCACCTTGCGCTGGCCCCAGAAGCTCTTGACGAC
GCTGATCGACAGATTCCAGCGTTCGCAAGCGTCCAACAACCTCTCAACCTTTTCACATAAAGCATCCCAAGTGGTCGCCGTAACGAGAATGTCGTCGATG
TACGACCGTCTTCCCAGCACGGACGGCTTCAACTCCGGCTCTGGTTCCCCTGCCTCGAACACATCAATCGGCGTCGACAGATCATGGCTAGCGCTGATTC
GGAGATGCCCATACAACGCATTGTCGATGAGCCTCTGATAAATCTGTGGAGCGTTCTTCAGCCCAAAAGGCATGCGCGTCCACTCGAAAAGTCCGAATGG
CGTGACAAAAGCAGAGATCTTCCGAGCTCGCTCAGTCATAGACACCACCCAGAAACCACTGGCCATATCGAGGGAGCAGTACCAGAGCACCTTGTCCAAG
TCTTCCAAGAGATCGTTGATCATCGGCATGGGATATACCATCAGTCGTGTCAATCCGTTCACCAGCCTGTAATCGATACAGAGTCGGATGTCAACACCGT
TCTTCTTGATGATGATCACGATCGGGGATGCCCACGGCGAGGTCGACGGAACGATCATCTCCGCAGACAGCAAACTCTTGATCAGGTCCGACAGCTTCTC
GCGAAACTGTGGGGCGACCCGGCGAACGCGTTGGGCGACCGGAGTTGCTCCCCCAACGTCGATGTCGCACACCGCGCCTACAGCCGCCGGGGGCAACGCG
TTTCCCTTTCCGATCAGTAGGTGACGCCGGCGCCAGATGATTTGCCGCAGACGATCGATCTCCTCAGGGGTGTTGAAATCAGGGTCTCCCACCTGAATGT
CTTCGATCGTGACTTCGTCGGTAGTGGTTGCTACCTCAGGCAAGACAGCCATCTGCTTTTCCACATCCTCCGCGAACAAGTCGCCTCCTTCATGGTAACA
GACTTCGTCGTCATCTGGTATCTCCGACTTGGTGATCGGCGGCGTCTTCGGCTCGATCATGGGCGCTCTTCCGATAGGCATCCCGTCACTTCGCTCTTCC
ATTCTGTCTGACGACATCTCCGTCGCGATCGGATTACCCTCTTCGTGCGCCCCATTGATCCCGGGGGCATTTGTCCTCGATTTCGTCTCAACAGGGCGGG
ACTCGGTGATTTGAGCGACCGCTACTTTCGACGCCCCGGAGTCTCGACTCCAGATCTTCGTCGGTGTGACGTACTGGGGTCGGTCTACCATCGGTCCAGC
GGGTCTCGTGTCTGGTTCTTCCTCGGGTTGCTGATCTGTTGTGGCTTGAAACGCTAGGTTTTGCCACTCAGCATACCGGCGTGACCCGATCAGTACGAAA
CCAGGAGCACGGGGTACGCGTCCTCCTTCGAGCCACATGCCTATGTGGGCAT