Description :
From Genome Similarity Track
Location :
contig_25:785177- 786649
Transcript NameFunction/comments
g5962.t1OWZ17409.1 hypothetical protein PHMEG_0008655 [Phytophthora megakarya

Sequence
1472 bases(100 bases per row)
CAACGCCACCGAGCGACGGGAAGGCGTCCTTGTCGCTGGCGTTGAACTTCTTGTTCTTGTTGCTCTTCTTCTTGGGAGACGAAACCTTGGTCGGGGTGGT
AGCCTCAACGGCAGTCTCGGCGGACTTCTCCGCCTTCGGGCGAGCCGTCTGCTCGCTGAACCAGACCTTCTTGGCCTTCACGGCAGCCAGCGACTCGGAG
ACAGCACCCACCGCCGACGGCGGCAGCAAGCCGACGGAGCTGAAAGCCTCCATCTGCGCGAGCGGCAGGACCAGCTTGGCGGCCTTCTTGGTCTTCTTTC
CGCGGGCCTTCTTGCCCTTCTTGCCGGCGCCGAGCATCATGAAGTCCTCCTCCTTGCGCTGGCAGGGGCTTCATGCCGTCGAGCTCCACGGGGGCGGCCG
CGGTCTCGGCCTTGTCAACCTGCTCGTCCTTGAGCTCCTTGCCGTACGTTTTCTCCAAGAAACTCACGAGGGCGTCGCACAGGTCCATCTCGTTCTGGAA
GGGGTGGATCTTGGCCATCTCCTTCTCGTAGTCAGCGAGCTTGGCCTCGTACTCGGCCTTGCGGCCTTCCTCCTCCTTCTGGCGCTCGAGGTCCTTCTTC
TTGCGCACGAGGCGGATGTTGTTGTAGTACTTGTCGTTGGCCTCCTTGAAGTCCTTGCGCAGGGCCTTGATGGCCGTGAACTTGTCGTCCAGCTGCTCCT
TAATCTCCTTGCGTTCCTTGGCGAGCACGGGGAACTGGTCCTTCTGGTTCTCCTCCTCGTTGAGGCGGTAGAGCTCGTCGAGCGCGGCCTTCTGCGCGTT
CAGCTTTTCCTGCACCGCGTCGATTTCCTCGTTCTTCTGGGCCTGCAGCGCACGCGTCTCCTTGATGCTCTCGTTCTGCTGGTCCAGGACGCCCTGGTCA
CCCGAGACGGCGCTCACCTGGAGCTTCTGGGCCTGCAGCTGCTCGATTTCCTTGATCACGCGCTTCTCCTCGTTGAGCGACATGGAGCTCGTCTCCTGCT
TGTGTCGCAGATCGGCGATGGCCTGTTCGAACTCGAGCTCTGAGCCAAACTTGAGCGTGGCGCGCACGCTGCGCTGCTGCTTGACGGACGCGTCCTTGGC
GTCGCGCGTCTGGCGCAGACGGGCCGTGATCTGGTTGCGCTGCTGGATCAGGTCGTCCTTCTGGCCGCGCAGGGCCGAGAATTGCGCCTTGGCCTCCTGG
ATCTGGCCGCCGTAGCCGCCGCGGTTCGTCTTGAGCGCGTCCATCTCGGCGCGGATCACGTTCGTGCGCGCCTGCAGCTTCTTGATAGCGGCATCCAGCA
CCGAGATCTTGGCCTCGTGCTCAGCCTTGTCGGGCTTGGGCAGGCGCTCGATCACGTCCGGGATCTCGAGCTCCTGTGGCTGCTCGGCGACGACGGCGGG
GACTCTTCACTACTCATCGTATGCGGCTTAGGATGACACGTACAGTCTCTCTATGAGGGGGATTTTGACTGG