Description :
From Genome Similarity Track
Location :
Scaffold_2:785105- 789779
Transcript NameFunction/comments
Phyca_LT15344484serine/threonine protein kinase

Sequence
4674 bases(100 bases per row)
ccgtatgttacgactattgtcatttatctcttacggccagcagacttggacggtggagccagggacatcatatcgtaccgatcgtcgaccatactgtgca
aaagaatgtatcgttctctcccaacaccacgcgaattgggctcaggagtcagcgacagaacttcctccattgtatacttgagctgcttccgataccgagg
attgttggcgcatactgtgtcaatgccgctgcgtccttcttccatcagagctgaagacatttcacgcaccaaagcgaacggaagatccactgataagact
ttcatggcctcatccccacgggacgagaagctggacgagatccacttagacacacgacgctgaaccttctgtgtatcaagctggtagttgcggtggttcc
tgtccctcgactggtacttggcgtccaccactcgaacgtcgaagattggctgcagcgtattgttattcgatgacgaactgccgccaccaccactgttgtt
gttgttcataccgtccccaaagtgggtgtgtcctcgcccactactggttgttgtgtctccatgggagtttttgccaacattcgccagtaattcgctgata
tattccggcaaagccactatattcgtcaccacatcagcctcggaatggctcttcaccgctcggatcttcacttgctgcttctcccgtatcatgtgcttct
gtacgatcaccatccagtgtacattctgctgagcgcagtagtcctcaaggtcttccaagtgtaatggttcggggtgcaagtagtccgcaccaatgccttg
tccccataagagcagcgcgatctgcatgcggaacagcattgtgtcagacgctttaccagccgagcagatcaagaccttccgtccaccagtcagaacttct
gagaccggtgctttgaactccaacagtgcgggactcaaggactcagccaatagtgagacgattttgtcaatggcaaagcgcacgcccatggcagctacag
ccgaagctttggcgtaggcggtagtgagtttgaagcgtgacaccagtgcatcgtaacgtccgccctccgcgataataatctggttatccgttcctgccac
caataacgaagcagatttgtcgccattattccctgcatacgtggcctcttcaagtaaaatggcctggaagatgaagcctgacgtgtatcgctctggacgt
ggactcaagcccaaatccaaccgtgtacacaccggacctgatagctggaggaattgcatggcctgtaacaacagacgcagagacgtgatgccctcattca
cgtccttcacaatgcgtcgtagctgtgcgtcgcgcttttgaatctgttttcggtcggctgaggatgaagaaccagaaccattttccccgtctgatcccac
cgttgagcctcggtttgcaagcgcacgattcttggcaaagagcttctgcacttccagctcaatcatgtcgagcgacgtcaggcaatcctctggcaagaga
aaaaagggcttcagagcgtcgatggcacttgctggagcgccgtagtgcttcaatcgtttcgcgataaatttccaacgaccaggttttaaacttggcgcct
gcgtggacggtggaccagcgtggacgtagaacgaaacatcatttgaaagcagtcgcagaacctcccgacgggcgctgctgggaacgcgacacaaatcgag
aatgccgcgcgtcattcgggcgtcattaaagcgtaaatagtaggatcccagacagcttggtaacgctttgatcacgcccgacaccacttgcaacccctct
agttccaagaaacggaacgaacccccgtcatcccaaataatgtcgaagtctgcctcggtgaactcccgcgggtggccaccgccgacgcttttccgatata
cacggtcgaattggaagcatttgagccgtgaaacgttgtgccgtgccacaaaacgagcaagcctttccgtcagatcaaatggtaaagacactgacacacc
gttgccatccagcatcattgatgcgtttgggggagcgctcagcgcgatgccgttgaagttctgctccgacagacgtggcataagcagcggcgtcgacatt
tcaactgctccgtgccgctcaaacactttctgtaggacgttcctgacgtaggttttagcgcgcaactgaacctcgtaactgcgcattttgaccgactcca
aatgatcgtacgtgtagtcgacatgattgagtggctcttgcgagacaagtgcgtcaattagctgtccaaagaacttaccctgggggtttgcgagcgtatc
caaggcctcacgaagataggacccttcaacctcaatctttggaggaagcagggggcttgccagcaactcttttgcattcggtcgcttggacggatcacgt
tcgcagagccacaacacgatcttcttgacgtcatcagaggcgctaaatgctgctggaagctcgtgtctttctctcagactggtcaacgcctgggcacgtt
ccatcagagttgtgaatggcggcgaccacatctcgaagaacataattccaagtgagaacaagtctgctttctggttgtatcgctgaccttcgcgttcctg
ctcaggtgctcgatagaacgctgtgccgactccagcggtgatattcccgtcccccacatccgctgacattgtggtcatgagattgctgttctgtacactc
gaccggccgacgactcgagtgctctccaagttctccagtttcagtctcccgtagagttcggctgctgatgaaccggttgactcggacaatatcgcgccac
tcaccgtttctccgggaggactggagtcgtcattactgctgtcatcatccaacaccttggcaggccgaacagcaagaccaaagtcacccagctttacagt
cccctcatagtcgagaaatacgttgggtggcttgatatctcggtggataattccctgacggtgaatatacaccaacgcctctagaatctggcggaacatt
gtccagatcttgtcggggtctttccacagcgctcccttgtcaatccctccctcagagcatttccctcgcagtactccatctggatatacaacttctcgaa
tttcctctttctctcaggaactggttttcggtgaggcagcaccttctggccatatacatcaccttcctcgtcgcttgaatcctccatctcttccattgga
gcttcttccaacgcctcccagtcgaatccatcctctggataactctcggactcaaatttgtgtgaagagagctggaacgagtggctattgctacgaaggc
ttcgaggttcgtggcgcgaagtcgaccaaagacctgtactgcttcccatcgcgcctaaccagtcatcttcatcttcgtctgtagacgtcatagcccccaa
gccgtcgtcaactccagaagaaagactcgcatcgccatacaaatcttcttttccactcaccaccgccccactcagctcactttcttcatcactgaagtcg
ctttcctccaaacttgaatcctcgtcgtcgtcacttgacattccactttcgccttcgatccaggcctgaaagtatcggacaatatgacggtgctgcattc
gtgagattgtcttgacttcacgcagaatcttctttttcatcattttatcgtccgggtccagcttgaccttcttcacagcataaagctgtcgatccagacg
gttcctcactttcaccacttcccctcctcctccacgccccaacagtcctagctccttgaaatctccgtgatacctcgaatgataccgttcagcagctgca
accgcgtccaaatccgacgtatctgagtccgaatccgacggactcgacgcacttccgtctctcttggaactcgcctccgtttgctgttcgtaaatactgg
acagactctctccttcacttccactcccagtatattccccatcaatactggagcgatgtctccttcttctccgtctcgtcttctttattgtctctctctt
cttcctttcagcgtcaatgagcgccaagatctcctcgctctgagctcttgccttctcctcttcttgttgcttcaacgcgtcctcctccatcttctccttc
gtctccatatcctgctgacgagtcatcatctggtcgaagaacgacgactggtccttcaaatggtcctggataaaatccgtggcgaacaccacgaggtcgt
aagtggaggcgtctccgaccttttcgagcgcgagcgtctccatgcctcgctgtagcttctgcgtctccgtgtctgacagtccgtgcttggcttccactgt
gatattgggcggctgcttgagcggataagctcgggagaagtcaaagtgcagcaaaacctcagccgtcgtagctgagcctggagtggcttcacataccagc
cgaatggcgaagatgtagctgtacaaaggcgtagcgctctgtgtcactaggtcgcggtcgaatatagcttctaatacttccagctcttgggcttgtagct
cccgtgcttcagctaatgtggcagcatcataggtggttgggggatcatgtgttgcatgggtgtctgtaggcgagaaaaacgcagattttaaccggaattt
cacgtagttagatagttgagatgtatagctagtaggttacctctcttcttgcccttcttgcggcccatggacgg