Description :
From Genome Similarity Track
Location :
Scaffold_5:784942- 786612
Transcript NameFunction/comments
g2960.t1hypothetical protein

Sequence
1670 bases(100 bases per row)
ACCTGGACAACGTGGCGGAGATGGACAACCTGCATGAGGCGCCGCTGCTGGACCTGCTGCGCCGCAGATACCTCGAAGACAAAATCTACACGTACACGGG
CGACATCCTCATCTCCATCAATCCGTACAAGAACATCCCCATGCTCTATAACTTCCCGGAACTGGACTCCATCGGCAAGCTGGACAACCCCGTGCCACAT
GTGTACTCTACCGCTCACGGGGCGTACCACGCCCTGATGAAGGACGGCAAGTGCCAGTCCATCCTTGTCTCTGGCGAGAGTGGAGCCGGCAAGACTGAGG
CATCCAAGTACATTATGAGGGTGAGCTTGAGGTGTTACTATTGTGGTGGTAATTAGTTCTAATGGGGTGGTGCATTGGTTTTGCTGCTGCAGTATCTGGC
CAATATTTCAGAGATCGGGAAGAAGACACCCAAGGCCCCTAAGACGGACAATGGTGGGTCATCGGTGGAGCAGTGTGTGCTGCAGAGTAACCCGCTGCTG
GAAGCGTTCGGTAACGCCAAGACGATCCGCAACGACAATAGTAGCCGATTTGGCAAGTTCATCAAGATTTACTACAATGCGGACGGCACGATCTCGGGTG
CTACAACGAGCCATTTCTTGCTGGAGAAGAGTCGAATCGTTGGCAGTGCGGATGCGGAGCGAAACTACCACATTTTCTACCAGCTTTGTGCGGGGTTGCC
TACTGAGGACAAAAATGCGCTGAAGCTGAAGCCTGCGAGTGAGTTTCACTTCTTGAACCAGGGCAACTGTATTCAGGTGCCGGAAATCAACGACAAGAAG
GACTTCAAGGAGCTTGTTGAGGCTATGGGAACTGTTGGTATCCCGCCAGATTTGCAACATACTATTTTCCGCCTGGTTGCGTGCGTGCTGCATCTTGGTA
ACGTGGAGTTTACGGAGAATGCCAAGAATGAGTCCGAGATTGCCCACCCGGAAGATGTCACGAACCTCGCGGAGCTGATGATGGTTACGCCGGATGAGCT
TGAGTTTGCACTCACCAAGCGAACGATGTCTGCTGGCGCGCGTGGCTCAGTGGCTGAAATTGCACTGACTGCTGTCGAGTCTGTGAAATCGCGTAATGGT
CTGGCGAAGGATATCTTCAGCAAGATTTTCGATTGGCTCGTGTTCCAAATCAACAAATCCACTTCAAACGTCGGCGGCAACTCGGGTGTGGGTGCGGGGT
CCAAGTTTATTGGAATCTTGGATATCTTCGGTTTCGAAAGCCTGCAAGTAAATTCGTTCGAGCAACTGTGTATCAACTACACGAACGAAATGCTTCAGCA
GCAGTTTAACCAGCACGTGTTCGTGTATGAACAGGAAGTGTACGTCGAGGAAGGCATCGACTTTTCTCGCTTGGAGTTCAAGGACAATGGACCGTGCCTG
GATTTGATTGACAAGAAGCCGCTGGGTATCCTGCCGCTTCTTGATGAACAAGGAATGCTCGGTCGACGCGCAAGTGACGAGAACTTTATTCAGAAGTTGC
ACCAAACGCATCTATCAAAGGGCAAGGTTCCTGAGGGTACTACTATTTACTACTCAAAGCCACGATTCGCCACGGATGAGTTTGTAATTCACCACTATGC
TGGTGAAGTTACGTACAATGTCGTTGGTTTTTTGGAGAAGAACGATGACTCGCTGCACAACGATCTGATT