Description :
From Genome Similarity Track
Location :
Scaffold_5:784931- 786422
Transcript NameFunction/comments
g2960.t1hypothetical protein

Sequence
1491 bases(100 bases per row)
GCACAGCGTGGACCTGGACAACGTGGCGGAGATGGACAACCTGCATGAGGCGCCGCTGCTGGACCTGCTGCGCCGCAGATACCTCGAAGACAAAATCTAC
ACGTACACGGGCGACATCCTCATCTCCATCAATCCGTACAAGAACATCCCCATGCTCTATAACTTCCCGGAACTGGACTCCATCGGCAAGCTGGACAACC
CCGTGCCACATGTGTACTCTACCGCTCACGGGGCGTACCACGCCCTGATGAAGGACGGCAAGTGCCAGTCCATCCTTGTCTCTGGCGAGAGTGGAGCCGG
CAAGACTGAGGCATCCAAGTACATTATGAGGGTGAGCTTGAGGTGTTACTATTGTGGTGGTAATTAGTTCTAATGGGGTGGTGCATTGGTTTTGCTGCTG
CAGTATCTGGCCAATATTTCAGAGATCGGGAAGAAGACACCCAAGGCCCCTAAGACGGACAATGGTGGGTCATCGGTGGAGCAGTGTGTGCTGCAGAGTA
ACCCGCTGCTGGAAGCGTTCGGTAACGCCAAGACGATCCGCAACGACAATAGTAGCCGATTTGGCAAGTTCATCAAGATTTACTACAATGCGGACGGCAC
GATCTCGGGTGCTACAACGAGCCATTTCTTGCTGGAGAAGAGTCGAATCGTTGGCAGTGCGGATGCGGAGCGAAACTACCACATTTTCTACCAGCTTTGT
GCGGGGTTGCCTACTGAGGACAAAAATGCGCTGAAGCTGAAGCCTGCGAGTGAGTTTCACTTCTTGAACCAGGGCAACTGTATTCAGGTGCCGGAAATCA
ACGACAAGAAGGACTTCAAGGAGCTTGTTGAGGCTATGGGAACTGTTGGTATCCCGCCAGATTTGCAACATACTATTTTCCGCCTGGTTGCGTGCGTGCT
GCATCTTGGTAACGTGGAGTTTACGGAGAATGCCAAGAATGAGTCCGAGATTGCCCACCCGGAAGATGTCACGAACCTCGCGGAGCTGATGATGGTTACG
CCGGATGAGCTTGAGTTTGCACTCACCAAGCGAACGATGTCTGCTGGCGCGCGTGGCTCAGTGGCTGAAATTGCACTGACTGCTGTCGAGTCTGTGAAAT
CGCGTAATGGTCTGGCGAAGGATATCTTCAGCAAGATTTTCGATTGGCTCGTGTTCCAAATCAACAAATCCACTTCAAACGTCGGCGGCAACTCGGGTGT
GGGTGCGGGGTCCAAGTTTATTGGAATCTTGGATATCTTCGGTTTCGAAAGCCTGCAAGTAAATTCGTTCGAGCAACTGTGTATCAACTACACGAACGAA
ATGCTTCAGCAGCAGTTTAACCAGCACGTGTTCGTGTATGAACAGGAAGTGTACGTCGAGGAAGGCATCGACTTTTCTCGCTTGGAGTTCAAGGACAATG
GACCGTGCCTGGATTTGATTGACAAGAAGCCGCTGGGTATCCTGCCGCTTCTTGATGAACAAGGAATGCTCGGTCGACGCGCAAGTGACGA