Description :
From Genome Similarity Track
Location :
Scaffold_107:78486- 81241
Transcript NameFunction/comments
Hyaar_Emoy2809677hypothetical protein

Sequence
2755 bases(100 bases per row)
ATGCCAAAGCAGTGGAAAGCCGCACAGGCAAGTCTACGGGTGCTTTTGGAGGAAGACGAAAACTACGTGCACTTTCTCGAAACTATTGAAAAAGAACTAG
CAAGAAAGCTGCGGTTTGTATGTCGGTCACGACGTGGGACGCTCGTAGACAGCATCGCCTTCGACAGGTTCGTCGAGGCAGCAGCTCAGCTCAAGTACCT
ACATGTGTTGTATCAAGGCAAATTAAAGCCGATTGTGGATATAATCGATGTTGAAGATGTCTACTCTGCTGACAGAAAGTGCGACGACCTGGTGGAGATT
GTGACAGATATGCTGAGCGTCCTCCGTTTTCTATACGGACACCTATTCTGTAGAAGGGATGCTACCTATTCAGCCCTGCAGAAAGCGTTTGGGAAAGGCA
AAAAAGATTGGGACGGTGAGCTTCTGGAAAAGTATTTGAAGACCCAACTCCTGACTGTTGACGAATTGGTGGCGCGTCCGCTAAAACGCTTCGATGAACT
CATTAACTTTGTTGAAAAGCTGAGCAAAACTTTCTCCAAAGATAGAGACTATGATGCCGCTCGCAATGGCTGCGATGTAGGCAGTACGGAAAGAGTCAAT
CGTGCTTCTCATCTAATGCATATCGTCCAGGAGAGCAAGAGCTATATACATCTTGTCAAGGGGGATGAACGAGATGAAAAGGAGTTGATTGCGTTGCAGT
CGTGCTTCTGCGGTGATAAGGCTAACTACTTTGATGATCTGTCAAGTAACAAGCTGATGCTTTGTGGAGAGGTGTCAATGTCGCATGTGTATGCTTGGAG
CAATACCAGTAAAGCTGGTATAAAGGCTGATACGGGATTGTTCAGCGATTTAAGCCTGATCTATGTACATTGCTTTCAGGATGGAACGTTAGTTTGCAGC
ACAAGACAGGAAGGTAATCCGCAGAAGTCGTTTACGATCCTGTATTGCTTACAGCTTAAGCGAGATGCAGCATTTATCGAGCACGTTCCAACCAGCGTAC
CCGTTTTCAAATCTTCCGATGAAGCGCGTGCTTTTACACTGATTAAACAAGATACGATACTTATTTTTATCTGGAAAGATGCGACGGAATGCCAACGTTG
GGCTGATACAATCAGAGGGTTTTTAGAAAACAACGGATCGCGGACTGAAGTGCTCCAACGAGGCCGAACCATCAGCGTACTACCTTTGCGTGACGAGATA
TCACAACAGCTTGTGGAAATGAATACTATACCGACGAAGATCGTATCATTTTACGACGATCACCTTCCCGGTTTGTTTTGGTTGGCGCCCCAAACCGATT
TGTGCTCGCCTCAGTGGGAACTTGTCGATATTGTCCTGTATGCTAGATGGCTACTAGTTTTGAAGGTAGAAGGCTGGAACAAGCACTCAACTTTGTATGA
TTTTGATACTCACTCTCCCAAAATGAAAATTGGTGAGCGGGTGCGTGGCGATGACGAGTGGAGCTTGGTAATTTCCGATGGATTAACAGTCGACATTATC
CTCGTATCAACAAAACGAACGAGGATCGATTTCTGGTTTGATCAAGTATCGAAGGCAGTGCAAAGCGCTCGCGCAGCAGCACAACGAAAAGAGAGGGATA
ACGAGGGATGCTTTGTAATTGACGAGCGTGGAGCAAACCCCAGCCAACTGAAAGCTGACTTGGCTAAGAAGAAAAGGAAGATAAGCGGGGGATCCATTAA
AACCCGAATGACGTTGGAAAATGAGGAGATGTCTTCAACAATGGAAGCAGTTGGCCTTTGTGGTGTGAATCTAGGCAACGCTTCCGACAAAGAACGAGAT
GAGCTCGATCACAGCTCGAAGGTTATCAACGTGGAAGGAAATTCAAGTGCTGCGCCCCTGGCAACGAAATCCAACAAGTCCTTCATCAAATCGAAAGAAG
TCACACCTATTGTAATTCCTGGAGAGAATAGCGCTTTCGCTGCTACTACACCCTCGCCTGCTGTGAAAACACCAAAGAGTAAGTGGCTAAAAAGAAAGGC
TGAGGATCCTTATGACACCGCACTAATGCCGACCCAATCAGCTCCAAGTATATCAGCGGATGAACCCATGAGTAAGATCTTTACTCCTGCTGAACACGAG
TCAAATGACCCAGAAGTGCGGATCGTCCTCACCGGCATTGAACCAACTGCTTCGATTCGAAAGAAGATTGACTCAATTTTGGGTGCTGCGTACGAGGAAG
ACGTCGAGAAGGCAACGCATGTTCTCGCCCCCCAGAAACAGTTCAAACGAACTGTAAAGATGCTTTGTGGAATATCACGATGTGTGCATGTCCTAGACGT
GCGGTGGCTTGATGAATCGGCGCGTGTGGGTGCTTCTCTGTACGAACGGGGATACTGTCTAAAAGATACGGAGGCAGAAGTAAAGTGGCAGTTTAGTCTA
CAGAAAATCATGTACGACTATACTCTGGACCAGCGACAGAGACTCTTTGCCGGTCATCATGTATTCATCACTAACCATAAGTCGGTTCTTCCGCCAGTGA
AAGACTTGGTGAAGATTGTCGAGTGTGCTGGTGGTACGGCGGTAGTTAAAGGCACTGCTGGTCCCAGCGATGTGGTAATATCGAGCGAGTCAGCCTTGGC
CACAGCATCAGTTCGACGAGCATTGACGCTAGCAAACCCACAGCGGATCTACTCCACAGAGCTTATTTTGAGCAGCATCTTGCAGCAGCAGATTGACTTC
AGCAAAAACCAGTTGGGGACAACAAGCAGCGGAAGTCGCCGGCGCAAATAGTGGT