Description :
From Genome Similarity Track
Location :
Scaffold_65:78477- 80489
Transcript NameFunction/comments
g1730.t1XP_008897855.1 hypothetical protein, variant 2 [Phytophthora parasitica INRA-310

Sequence
2012 bases(100 bases per row)
GTGGGCTCATACCTCACGAGTCCGTTCAACAACGGACCCGTGAACGGCACGTACATGTGGTCGGCAGAGGAGTGGCGCGAGGTGGTCACAAGGATCCAGG
ACATCACCATGGAGGAGAACGGTGGCCACCCGATGGTGTACGGCGTCGACTCGGTGCACGGCGCCATCTTCGTGAAGGACGCCGTGCTGTTCGGCCAGCA
GATCAACGGCGGCGCTTCGTTCAACCCCGACCTTGTGTACGAACAGGGCCGCATCACGGGCCGCGACACGGAGGCATCGGGCGTGCCATGGGTGTTCGGC
CCCATTCTCGGCATCTCGCGCAACCCGCTGTGGGCCAGAACGTTTGAGACGTTCGGCGAGGACCCGCACCTGAACTCCATTATGGGCGACGCCATCATCC
GCGGCCTGCAGAGCAACAACCACACGGCCGCTTGCATGAAACACTGGATAGTTTACCCTAAGACGCCTTCAGGCCACGACAAGGACGCCGTGACGGTGTC
GGACTACGACATGATGAACTACTTCTTCCCGCCCTTCAAGGCCGCCGTGGACGCCGGCGTGATCAGCGCCATGGAGAACTACATCTCCATCAACGGCGTG
CCCACCGTGTCGAACACCAAGCTCATGAACGCGCTGCTGCGCGACGACCTGGGCTTCGACGGCATGATGGTGACGGACTACGCCGAGATCAACCAGCTGA
CCGACTTTCACCGCACCGCGCGCAACGAGACCGAGGCGACGCGCATCTCGCTCACGCGCGCGTCCGTGGACATGAGCATGGTGGCGCAGGACACGAGCTT
CTACAACGGCACGAAGGCGCTGCTGGAGCAGAGCCCGCAGTTCCGCGAGCGCCTCAAAGCGTCGGCCCGCCGCGTGGTCAAGATGAAGCTGCAGCTGGGT
CTGTACGAGACGCCGGTGCCCGGGGAGGAGAACCTGGCACTCATCGGCAACGACGACGATATCTCGGCGGCACTGGAGCTGGCGCGCGAGTCCATCGTGC
TGCTGCAGAACAACGACAGCACGCTCCCTATCGCCGACGACGCGTCGGTGTTCCTCACGGGCTTCACTGCCGACAACATCGGCCGCATGTGCGGCGGATG
GACGATCGCGTGGCAGGGCTACAGCGACCAGGATCACCTTCTCACGAAGGGCATCACGGTCAAGTCGGCCATGGAGACGCTCGTCGGCAACGACAGCTTC
GCCTTCTTCAACGGGTTGCACCCGAACGGGTCGTACTCGGAGGCGGACATGGCCACAGCCAAGGAGATGGCTGGCAAGGCCGAGTACACCATCGCCGTGA
TCGGCGAAGACACGTACGCCGAGAAGCCTGGTGACATCGACGACTTGGCGTTGCCCGCCGGTCAGATTGAATACGTGAAGGAGCTGGCGTCCACGGGGAC
CAAGGTCATTCTGGTGCTGTTTGAGGGTCGTCCGCGTCTGCTCGGCGACCTCCCCGAGAACGTGCACGCCGTGGTGAACGGCCTATTGGCCTGCGAACTG
GGCGGCCAAGCCATGGCCGAGATCATCTACGGCAAGGTGAACCCGAGCGGCCGCATGCCGATCACGTACCCGAAGGACCAGGCCAACATCCAGCTGACGT
ACAACCACCCCGTGACGAGCATGTGCCAGACGCAGGAGTCCAGCAGCGCCTACTACTGCGAGAACCAATGGGACTTCGGCACGGGTCTCAGTTACACCGA
GTTCTCCTACTCGGAGGTGCGTCTCAGCCGCAGCGTCGTGGAGGTCTCGACCGAGGACGTCGTGGTGTCTGTGGACGTGACAAACTCTGGCAGCGTGGCC
GGCAAAGAGACCGTGATGCTGTTCCTCATTCAGCCGTTCAACTCGCTGAACGTGCCGGAGATGAAGCAGCTCAAGAAGTTCTCCAAGATCAGCCTCGAGC
CCGGCCAGACGCAGAACGTCGAGTTCACGCTCACGGCGGATGACTGGAGCGTGTACTACCCGCAGGTGGGCCACGGCCTCAAGAAGGTGGCCGAGGACTG
CGACTTCGTGGT