Description :
From Genome Similarity Track
Location :
Scaffold_812:7847- 12344
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_812-snap-gene-0.7Alpha mannosyltransferase

Sequence
4497 bases(100 bases per row)
ACTCGCGTAGCGTCCGAAACGACCCACAGTCGATGAAGCTTCGAGGGTTAAAGAGCGTTGCGACAGATGTGGAGTTGCCCCAGTAGATCGGGATCGCGCC
GGCGAGAAATGCGTTCACGATCTTCTCCGTCACGTAGCCAGGCGCGATCGAGTTCTCGAATGCGACAACGAATTGGTAGCGTTGGAATTGCTTGACAGCG
TCATCCAAGTACCATTCAGACTGTCTAGAGGCCAATTTGCGGAAATCCTTGCGCGTCGACGCCCCTGCGCACGCCCCAAGCGCGTCCACCGGCTTCAACT
CGTTCAGCATGTCAAAGAAGTACTGTCGATGAGGCCACTCGCACTGCGAGTACAGGAACGCACAGAACTCCCGGTGATGCATGTCGCCAATGTGGGATGG
GGAGAGCAAATCCAACGGCGAATGGTCCAATCGCTCCGCGAACGAGGCGCTCGCCATCGATATGTACACACGTTTAAGCTGAGATGTGTGGGAGACAGTC
GATACGAGAGTAACCGAATCGTCCAAGCCGTCAATATTCCACGATTCGCCCGAAAACACCATGATTCGGGCAGGATGGTCGCGGTTGTTGGCCACTGACA
TTCGGCAATGACGGTGGCTACACGCAGCGTCGAGGATCGAAAACACGTACACATCTGACTCATCGCGGTAGTGTCGCGCGACGATCTCCTTGCCGACCAC
AACAACGGGGTTGTCCGTGTACATGGCGGCGAAGAGGCATTCAAGGATGATTCGGTGACAGGACGCTTGGTTGTGGAAGCCGATGACAGCTGGTGGCGCG
TTTGCATTGGCCACGAACAGATTATGACGCCAAAGCTCAAGACGCGATCGATCTAACATGCCGCTTGCTTCAGCTTTGATGTAAAGTTCTTCGAGGTGAT
CTCGCAGTTGCATCTCAACGCTCGAGCAGTCAATAATCCATCGTAAAAGCAGTTGGCGAGCGTGAGCACACACTCGACGGGAGAAATGAGCAAACGTCTC
GGCTGACGGAGTATATGTGAATTCGACACCATTGATGGTCATGGCTATTTCGATGGTGATTGTAGTCCGAATATCTCGTACCAAGGACATGAGCTCGAGT
TTAGAACTGCGGCGCCTTAATTCGTGACTTGTGTCGTCTTTCCGCCACGCGAGTGAGTGGAACCCATGGCAGTACGCTCGACCGGCCAGCAGATTCGAGT
GGACCATGCGAATTCCCAACGGTGACAGGTCTGCAAATGAAATCAAGTGTTCTAGACACTGGCCGCTTCGAAGGTGCAGAAACTTGTCCGTGTGTTGAGG
GTGTACTTGTATGGCCAACAGCCACAGCGCGACGCTGATGTCATCCATGCCATTCAGACCATGCAGTCTCTGTCGGTTCTTGGCGATGAACTTGGCGCAA
TCCATCGATACGACGTAGTGTGGCCCGAACCCGAACGGGGGCAGATAATGCATTGGGTATACCGTCTCAGACAGGAAGTACCGTCGAGTGGTGTCGCGAA
TAGGTCGCGAAGATCTGTAGTATTGACGATCCCATACTTGGCTGAGATAAAGACGCTCTGTTTGGCCGCGTCGGACGAGTTTCTGCTTCAACTCGTCAAC
TTGCAGGTGAACGTCATCGTCGACAAGCATGACATACGTCGCTCCACTGAACATCTCCACTGTCCAATGGATAAACTCCTTCACCTTGCTGTGCAGGTCA
CTGTAATTATCGTTGCAGTCCAGTTCGTCAGTCAGCAAATCACCAAACGCTTGTTTCTCGAGCGTTATTGCTCGTGTCCATTCTGTCTTTAGGTCGGGTG
ATCGCAAATCGTCGAAGTTCGACCGACAGCCGATGAAAACCACCCGAACGTCACTTGGTAGCGAGCTCGCACTTGCCCATGTCTCCCGTATTGCCTGCCG
GAGGTGAAAATTGGTTCTCACGACTGTTTTCACTCCAATAACGAGCAGCGGATCCGGATGCAGCACTGACGAGTCGGTTTCACCTTGGTGGCGAGAGGTC
ATCGAGCGCGCGGGAAACGGTATGTGACCTTGTAGACTCTCATATGCCCACGATAGCAAATGCTGGTCTCCAGGGAGGTGATACTCGCGACGCAAACGTG
AAGCTTCGCTGTCCCAATAGGATGCCATTGTTTCATCGGCTATGACCGCGAAGGAGATAGTTGCAGTTTGGTGATATCGCTTACGCTCGGTGCCGGCTGT
TCCTATCTCGTTATCCCCGATAAATGCCCTGGCGACATAGTTGCCAGGCTGCAGATCATAGACACTCAAACTTGGCTCCTTTAGACATGCGCACTTCATG
ACACTGTCATTCAATTCCGCACAGATGGACAAGTTCTGGCTCACGGTTTCGAACTGGGCGAGGTCGTCGACTCGAATATTTGTCAAGAAATGGACGGGCG
AGAGGACGAGCTCGCCGTCACGAGGAAGCACGAGCTCGAAAAGGTTGATCGGATCGTGCTGCGGTTTGTTCTGGGCCGTTTCGTTGCTACGAGGATCCAC
AGACACGAAATCAAGCGATGGATCGTTGACATGCACTACTGACCGCACTCTCGGCGTCTCCTTGAACCACGCGGTTGAGTGAAATCCATCGCAGAACGGG
AAACCAGCTTGAAGGTTGCTGTGAATAACTCGTATTGCCAACGGGACCAGATCTGCAATCGCAATCAATTCGCTATCGCAGGGAGCGCCGCGTACGTGCC
ATAGCCCTGGCAAATGGCGAGGATGAACCTGGATCGCAAGCAGCCACAGAGCGACACTGATGTCGTCCATCCCACCGAGACCGCGCAGTTTGTGCCGATT
TTTGGAAATGAACTTGGCGCAATCCATCGATAGTACGTAATGCGGACCGAACGCGAATGGCGGGAGAGTGTCCATCGAGTAGACTTCCTCGGACAGGTAG
TTCTGGTGGAGAGCGTCGCGAGTGGGTCGTAGCTCTCTGTTGAACCTTTTGCTCCAAACCTGTCCGGCGTACAGCTGAACAGGGTCGCCTTGAACAACGA
GGAGTTGCTTTAGCTTTTCGACCCGGAGATATACGTCGTCGTCGGCAATCATGACATACGATGCAGAGTTGTAAGTGTTCACCGTCCAGTGTATAAACTC
CTTGACGCTGGTGTCCAATTCATGGTACAGATCGTCACAGTCAAGCTCGTCGGTCAACAAATCGCCGTAGACCTGCTTCTCGAGTGCCACCGCTTTTTCA
AGCCTTTGCCGTTCGACTGTATCAAGAGTTTCGTCGTAATGTGGCCGACATCCGATAAATATCACTCGGGTATCGTCCCGAAGCGACTGTTTGCTGGCCC
ACGTCTCTCGGATCGCCTGCCGGTATGCAAAGTTGTTGAGGACATCCGACTTGACTCCGATCACCAACAGTGGAGCTCGATTCGAGTGGGGTAGATCGCT
TTCACTCACTTCCGCGTACTTCGATCCAGAAACAGCAATTGTGTCGATTCGTTGCGACCACAAGAGTAAGTCCGGGTCGGGTGCAATACGATATTGCTGC
CGTAAGGCGTGGTCTTGGTCTTTACCGCTTTTGGCGAGAGTTTCGTGGTCCACGATCGAGAAGGTCACGACTCCAGTCGGATGAAAACGCCTCCGATACC
CGAGCTCTGGCTCCGGTTGGTCGGTGATAAACGCCGTTGCACTGTAGTCGCCGATTGCGAGAGAGTCGAACTCCATTTGCGAGTGCATCAATGGCAGGCA
TTTCGTGACCACTCCATTGAGCTCGACGCAGAACGACCGGTTGGCATACAGCGATTGAAACTGCACCGTGTCATCGACTCCTATGATGCACCTGACGGTA
AACGGCGCAGATACAAGGTCGCCGTTGGCAGGTGCAATGATTCGGAACTCATAGACCGGGTCATGGAAGGAGGAGCTCTCATGGACCTGGAGATGCCAGT
CAGTCGCCCGATTTGAGAGGCCACCGGCGACGTCGATCCCGACAGTCGAAGCGGTTGCGGATGCAGTGTAACCCAAACTGCAAAGCACTGCGAGCGCGAG
GCAGTGCCACATCCAGCTCGGTCCGGGCATGCAACTCGAGGACCAAAGCAAGGATCGTGTCGAGCAGAGATCTTTCTGCGCCGATATATCCACATAAAAT
ATGGAAATATACCGTTTATACTATGAAGATATCAGTCATTAATACTAATTATGTATATTGTACGATTATTGAGCACATCACGCGTCTATGAGGTTGAACA
GGCGTCTCCGAGCCTTGTCGACTGCTACGATGGAATATCATCAATTTGCCGACACAATTTGCCGATACTTTCGTACTATTGTACCACTCTCCAATACTCA
CACTTCACATTTGTAATGCTAGAATCTGTGTAGCATTTGAGCGCGATGGACCAGGACGGAGACTTCGAGATGGCCAAGGCATAGCTAAGTCTCATTAATT
GTATGATTACTGACCGACAACATCGTTTTTTCCGTAGTGCAGAATTGAATTCTCGACACAAACCAGCGGCCATGAGAAGGCTTTCTACGCCAATCAA