Description :
From Genome Similarity Track
Location :
Scaffold_705:7846- 9918
Transcript NameFunction/comments
Phypl_g10447hypothetical protein PHYSODRAFT_508531

Sequence
2072 bases(100 bases per row)
ACGCAGTAtggtacttcgaagtagctAGCTGTAGTACATTTGGAGCTTGCTGTTCAAATCCAACAATAGCATGTCGCTTGGCTTCTTCAGGTTGATATTG
CACTCTCGAACGTCAAAAACAACGATGTCCAGACCCGCAAAAAAAGCATAAACCGAGTGACCGcgattgctgctgcttaaCTTGTGCGCAcgcgcgcggc
gtcggccatgcCCGTCCAGTCGGTCTCGCAGATCTTGACAAACGACACGACAacgccgaagaagatgccgatCGTGAGGCCGAGCCACATTCCCTCCACG
CCCATGTCTATCCAGAAGGCCAGGACCACGCCAATAGGCAGGCCGAGCACGAAATACGCGACCAGGTTGATGCAGGCGCCCAGCGTGAGCCGCCCCGTGC
CGCGGAACACGCCCTGCATGACGGCGTTGATGGCGTCGCACATCTGGTACGGCAtgaggaacagcagcgcgtggccggCGAGCCCGATCGATAACGCGTC
GTTGATGAAGATTTCCGGGATGAAATACCGcgtggcgatgatgacgacggcgaggaccGCCGACAAGGACACCGACAGGATCATGCCCAGCGTCGAGGCC
ATCTTCGCGTGGTGGGGCCTGTTGCGTCCCAAGTAGTtgcccaccagcacgttggcTGCCACCGAGATGCCCAGGAAGAAGTTGAACGCAAACGTCGACA
CGTTCACCAGCACCGAGTGCACGCTAAtggccacgacgctgctcggCAGCCAGCCAACGATGGCCGCCATGATCTCGAACGAGACCCACTCCAACTCGAG
CATCAGACATCCTGGCACGCCCAGCTGCAAGAAGGTGCCGAGGTGGCTCACCGCTTCCTTCGCCTGCCAGCCGGGCCACCACTCGGCGGGGATATGCGGG
TTGCGCCAGTAGTACGGGATGAGACACAGGGGGAGCGCCAATTCCGACACCAGACGCGCGATGGCAGCGCCATCGAACCCCAACGACGTGTAGAACGTCA
GGTACACGCCGAGCCCGAGGTTCACCAGGTTACTGATCACGGCAATGTATACCATCGGATGCACCACATTCTGGGCTTGCatcaccttcttcagcatctc
gTAGACGTACATGGCCGGGATACCAGGCAGCAGGATCTGGCTGAAGCGCCCCGCCAACGCTGCCACTTGCGCCGGCTGGCCGAGCATGATCAAGAAGGCC
TCCGTGTACCAGTTGATGACGAGCACGGGGATCAGCGTGACGCCCAAAACCATGAGACCACTCTGAAAGTACACGCCAAGCTTCTTGGGCCTTCCAGCAC
CGTACGCTTGGGAGCACAGCGTGTCCATGGCAGTGGCCaggccgaagccgacgccgATAGCCGTCAGGTTTAAGACCATAGTCGAGAGGGCCACGCCATC
CAGATACTGCTTCGTCAAGGGCGAGTCCAAGTGGCCCACCAGCGTCATACTCACTAATTCAGGGAAAAACTCGAGCACGTACGTGAAAATGACCGGATAC
GCCAACGTCAACATCTTGCGCACCTCTGTCTTGAGCTCCGGATGAACGTGGctctccacctcctcttccagAAGAATACCCGACTCAATGTCCGTCTCCG
AGTCCCGGGAGTACGGCTGAAGCAGCGGGAGATCCTCGGCGAACTTGCGTGACTTGCGTGCAGGTGTGGACACAAGCACCTGCGATTCCCATCGGTCTGC
agccgagaaggacgacgaccgaATCGGGATCGCCACCGCGTTCGTGGGGCTATccgagctgttcgacgagctgtacgaaCTGTTGGACGTCTCCGAGTCC
TCTCCAGACTCTTCCGATCCAGACCGGAAGTTCGCCTTCGAGCGCACATGGCGGTTCGGTCCATTCAATTGCTTCTTGAGCCTGTTTCCGCCTCTCGGGC
TCAGCAACGCGTGCGCTTCCAGGCTCCACTTCTCCACATTGGACTTCCACGACGTCGCACTGGCGTCGTCACTGGGGGGTTCCGACTTGGTCGACTTGAG
CGTGCCGTACCCCGAAAACTGTCGCGTCatggccgccttcttcttgggcttggcgtccagcggtTGGAGCTT