Description :
From Genome Similarity Track
Location :
contig_16:784547- 786052
Transcript NameFunction/comments
g3672.t1hypothetical protein

Sequence
1505 bases(100 bases per row)
GGATACGCCGTCGTCCAGACGCCACCGGCCGTCCCCACGACGACGGATTCCTGCTCAACATCGAGGAGCGGTCGCTCCGGCCGACGTGGATCGTGTACTC
GTCTGTGGCCATCGCCATGCTCGAGGCCTTCCACTACGGCTGGTCCAACTCGCAGGTCAACCTCAGCACCTTCAGCAACACGGATGACTGCAACGCGCGA
CCGGTCGAGGACGGCACGTGCCTCATGTTCCCGGGCCACACCAAGACGACGTGGACGCTCTTGGTCAACGCGTGGATCGTGGGCGGCATGTTCGGCAGTC
TGCTGTCGGGGTTCCCGTCCAACAAGTGGGGGCGTCGCACGACGCTGCGTTCAACGCGATCCTCATGGTGCTGGGCTCGGTGGTCCAAGTGGTGGCCAAC
AACCCGACGTGGTTCGCGGCGGGCCGCTTCGTGACGGGCGTGGCGAACGGCGTGGCTATGGCCGTGGTGAACACGTTCCTGAACGAGATCTCGACGCCGC
ACAACCGCCACGCGCTGGGCACCAACACGCACTTGGCCGCGACGCTCGGCATCTTCGGTGTGGCCACGACGTTCTGGTACTGGAACACGACGTCGGGTTT
CCGTTGGATCGCTGGTATGCCGATCGTGTTCGCTGCTGCGTTCGTGGTCATGTCGTTCTTCTTCATGGTGGAGAGTCCAGTGTGGCTGGTTGCGAATGGG
AAGGATGAAGAGGCTGAAAAGGAACTGGGTAGGCTGTACGGCAAGGAGAACGTCAACGTTATGATGGGCTGGATCCAGTCGAACGACCGCAGGTCCAAGC
TGCCGTCCATGCTGAGCGGTGCGTCCGACAAGGTCAACACGGAAACCAACTGGACGATCCTGACCAACAAAAAGTTCCGCAAGCCGCTGATCATCGCGCT
GGGACTGACGTGCATCAACCAGTTGGTGGGTATTAATGCTGTGTTCTTCTACTCGTCGTCGATCCTCAAGGACGCTGGCATCTCCGATTCCCGTGTTGGT
CTCATGATCATCGACATCCTGAACGTCGTTCCCGTGCCGATCGCTGCTGCGTTGACGAAGATCATGCGTAAGCGCACGATGCTAATCTCCGGTATTTCTC
TCATGGTGCTGTGCTGCATTGGCATGACGTTCTCGCTGGTGTACAGCGTCGGCTGGCTGTCTATTGTGTTTCTCGGTCTCTTCGTGGTGGGCTACGATCT
GAGCATTGGCCCTCTTCTCTGGCCGATTGTCGCTGAATTGTTCGCGGACTCGGCCCGCGGTGCTGCTGTGGGTATCTGCATCACGATGAAGTGGATCTGC
TCCCTCATCGTGGGCGTCGGCTTCCCGTACGTCGAGGAGGCGATCACGAACTACAGCTTCACGCCGTTCCTGGCATCGACACTACTGTCGATCACCTTCA
TCTACTTCATGGTGCCCGAGACGTCCGACATGACCATCGCTGAGATTCAGGACGGCTTCCGAAGCGACCGTAGTGTGCAGTCGTCGAGCAAGAGCCAAGT
GTAGG