Description :
From Genome Similarity Track
Location :
Scaffold_206:78453- 83500
Sequence
5047 bases(100 bases per row)
ATTGACATCTCCAAGTACAGAAGAGTCGAGGAAGACCCCCTGTAGAGATGTTTCGTCGAGTTAGGCGACGCCATAAGAGCTCGTCACATCGTTGATGAGC
AAATGCAAGTCGCATTTGCTGAGTCGAACTTGGCAGGACGTGCCAAAACTTGGGCACCAGATCTCAATTTGCACGACACGTACGTATGTGGGTCGTAGGA
GTTATTTAAGTCCTGGCTCAGAAAACGTTTGAACCGCAACGGGATGATTCCACAGCTCAATCAGAGCCTGCGAACCTTAAACAGGGTAAGCGTAATGTGC
AAGCTTACGCCCAACACATAAGACTCCTTGCGAGCTGTATTACGATCAACCTGGTCCATAAACACACGTTAATTACGGTGTTCATGCAGGGCATTGCGGA
TGGTCCCGTCGAGACCCACCTATTCCGCCTGGAACTGGATACGCTAGAAGAAGCAATATCAGTTGCGGAAAACCGGAAGAATTTTGCTTAAGGTAGGCTC
ATGCTAGTTCGGGTTCATATCGCCCCTTACTAAAACGACAAGAAGTGGGAGGTCCAGAACCTATGGAACTTGGTAATGTTGAGAGCGAGAGACCTTGCTC
TTCGAACAACAAGCGATTGCAAAAGTGCAATCGCTGTCAGAAATAGGACACTTCGCCTACGAGTGTAGTGCCCTACGCACAGTGTCCCGAAACACTGAGC
GGACTGATCGACCGTCTGCCAAGAAGGGCAACAGACGCAGGTCCAACGTTGTTGCGAAATCGCAACAATGAGTGGACCGTAAAAAATGGTCGGAGTTAGA
AGAGGCGGAGCGCCATACTGATCTAGCAACCTCAAGAGAATTTGCAAATATCTTGATGAAAGCTGTACAAGACTCACACTCATTGTGTGTCTGCACTTGG
TGAAGACGTAAACCTCATCACCTTGAATTTGGAAGTGACAGAAGAGTTGTCACTTCTTGACCTAGTTGACTGTTGGGCATCGAACAACTTTGTTAGTCGC
CAATCGCTAGAGGTTCGTAGGCTCAAGTTCGTTGAGCACGACATCCCTCTAACGAAGATGACGGTGCGCCTAGCAACAGGCGCATCGATAACATTGATGA
AACGTGTAGTGGGACTTCACAACACGCTGGAAGATTTGCAGTACGATGATGATTTCATCATACTATATTTTGATGACAAATTTGATGTCATCCTAGGGTT
GCCTTGGCTCCGAAAATACGAGCCAAGGGTTAGCTGGCAGCATCGATCCATAAAGATGCCTGCCACTTGTTTATCAGATGGACACCTGATGAATGTCTTG
GAGCATCCACAAGCGTGTGGATGTACTACGAGTGATTTCGATGGTATCACTTGTGGAACGGTCGCTAGTACGAATGCAAAAGATTGCAGCGTGACAACGA
ATCACACTGTGGAGGAAGCTGTCGGCGGCTGTGCGGATGCACATGCAGCGCCGAAGGTCCACCACTCGAACAAGTCGAGTGGATCGGGACATGGGTGTAC
GCCTAGCGGGCGACATTCAAGGAAAAATAAAATTGTTGCCAACACAGGGCAACACGATGATCCTAGGTAGACTGGAGAGTCGACCGTAGAGGACCTGGCT
GTGGTAGCGCAACCACAGCTAGAAGACGTCGAGGAAATAAGTCCTCACGTACTTGAGGGAGAAATTCCTCAAGCGGATATTGTTGAGTTTATGAGACCTC
ATCAATAAGTCCCCAGAAGCCAGTGGAAATAGGTTTTCAGGAAGGAACTGAGACATTGAATGTCTTGGTTAATGAAGGGTCAAGTGTAGGCGCTTATACA
CTTGATCTGATCGCGCCTCCGAAGTTGAATTCGGAGATCACTCAGCTACTTACGCTAGAATCAAAACGGTTCTTGCAAGGTCTGCGTAGTGGCAAGGTCA
AGCAGATCTGCGTACTCGTCGCAGAGGACGATTACGTGATCGATTCGGTCGGTAGTAGTATTCGCCGAGAACGAACGGGTTCTCAGCAGCTCATCGATGA
AAGAAAGTGTCCTCGATGAGAAGACTCGTATTGAACAATACATATCTCAATCTTGGGAGTCGACGCAGTCAAATCCTTAATATGAGGATTTGATCGAATT
TAAGGATGTGTTCCCTGAATCCGTACCATGCGAGTTACCTAAGGATAAAAGCGCTCGACATGAAATCGAGCTTAAACCGGGCTAGAAGTACTGCGTTATG
AAGCAGTGGTCACTCGCTCGTGAACAAATACTTGCAAGCGACAAATTCATTGCCGATAGCTTAGGAGAGGGCTAATGTGATGGGGTCAGCCTCCCCACAT
AGCTCTCCGACCTTCTGTGTGCGCAAGGCCACAGGAGGATGGTGGACAGTGCATGCATTTAACAAGTTGAATGCTGCAACGGTACCGGCGCAGACGCCAA
TCCCGAGGAAGGACGTCATCATAGATGGTATGGTAAGGAGTACCACCTTTTCGTCCATGGATCTTATGAATGACTTCTATCAGATCATTATGCGTGATCA
AGGCATCCCGTACACAGAAGTGAGCACCACTAGTGTTATGCTCTGAGAGCGGCTAGTAATGCCACAAGGGCTGAGCAACTCCACCGCTACATTCAACAGA
TGCGTTACGAATCTGTTAAGACTGGTGCGAGATTTCGCACCGAGTTACTTCGACGATGTATTCGTCCGTAGACGGGCTATGGGCGGAAAGAAGGACGTGG
AAGTTCATAAAACACACTTTCGTGAGGTTATTACAATTACGCAAGCATGATCTGTACGTTAAACTCAAGAAGTGCGTATTCGCTGTGAGTGATATAACAC
CTCTTGGATGCATCGTGGGTAAGCACGGCAAACGCCCTGATCCGGAAAAGATCACGGCGATTACCGACTGGCCTGTGCCAGTCGGTTTCAAGGGACTTAG
AAAGTTCCTTGGACTAGCGGCGTTCTTGCGCAAGTACTGCGCAACAATGACGTGATGACCGTTCACCTCTCTCTTCTCTTTAAAAAGGACGAGAAATGGT
CATGGTACGCTGATTGACAGCATTCCTTTGAAGGTATCAAGCAGGAATTGATAAAATCGCCCATCTTGGCGATTGTAGATCAGGACAAACCATTTCATAT
GGTCTGTGACGCTAGCGATTTCTCAATCGGCTGCGCGTTAAAGCAGTATGACGCAGACAGCGCAGAGCGAGTCGTCTGTTATAGTCACTCCAGCTGCTTG
CAGCTGAGCGTAATTGCCCAGTGCATGACAAGGAGCTCCTTGCCATGAAGTATGCACTGGCTAAGTTTCGCGTCTATCTTGTAGGAGATAGACCGCTCGA
AGTCTTATTCGGACCATGCGTCATTACGCACGGCCGTAAACAGTCCACACCTCTCCCAAAGGATGGCGAGGTGGCTGTCCAACTTCGCGAGGTACTATTC
TCCGTAGAATGTAAATTAGGACGACTTAGTGTCGTTTCTTATGCGTTGTAACGACGACCCGATTTCGAGTCGGCTGCGCAATCCAACAGTGGGATCAGCA
TTTCTGTTACAACACTAGTTACAAGTGTTCCGTCGTCAACACTGGTTGACGACATAAAGAAGGCCTACGCATAAGATAAGGCTCTTCTGCGACTGGTGGA
TCATCTGGTGAATCTATCTCGTATCTCTCTCAAAGATTTACCCGCCTTGTATCGATCCGCCGCAGATCAATACACAACACACAACCGGTTGCTGTATTAC
AGAGCTGTTGCCGGCGACACACCTAGTATCGTCGTTCCTAATTGTAACGATTTGCGCAAACGCATCATGAATGAGTAACAAGATGCACCAACTAGTGGGC
ATAGTGGGCGTAAGAAGACTTGCCTCACGCTAAGACGTGACGTTTTACTGACCTCGCCAATATCAGCTTGTGCTCAAGTACATTCGTGCTTGCGAAGTGT
GTCAACGGGTGAAGCGTAGTCCTTCATCTCGAGCGCCACTACAGCCTCCACCAATCTCGGCAGAGTGCTGACAGTCCATTTAATGGACTTAGGCTACGAA
TTCCCCGAAGACGCACACAAGAATAATGGTATTCTTGTGTTCATTGATCGATTCAGCAAGATGGTACACCTTGTTGCAGTTCAGGAGTCGATCACAGCAC
AGGGATGTGCCCGTGTCATTATCGACACAAGCTTTCGACTCTACGGGTTACCTCGTGAACTAGTCTTTGACAGAGATCCACGGCAAAGTTTTGGCAATCC
GTGTCCCGATACTCGGAACACGTCTAGCTATATCCTCATGCTACCATCAAGAGACTGATGGTCAGACGAAACGCGTCAACCGCTTCTTTGAAGAAATTCT
TCGCGGGCACGTCCAATCTTTCACAGACTGGAGTGAATTTTTGCCGACCGTTGAGTTTGCCATCAACAACTCCGTGCATGCGTCCACAACGCATACACCG
TTCTTCGTGAATAGCTTGCGCCATCCACGTCTACCCGCCCAATTAGAGTGTGACTCTGGTTTAAGGTTGGAGGAACTCGCTAGAGCAAAAACCGCTCTGG
CTTATGCTCATCATGTGTGGACCCCGACAACGAAAAAGTTTCTGATGTCGATCAAATCGACATCAAAAAGGATAGCTTCAGTAATAGTGACGAATCTATT
GATGATTTAGATGATGATGACGATGCTGGTATATTCAGTATCGATAATGATTACACCAGCGAACACCTTCGCTGAGGAAGAGAATGATCTCTTAGCAGTG
CGCACTAGGCGCACTGCAACAAACAAAGGAGAGTCAGCAGAAAGATTCTGCTGTCACGAGAATCAGTGGTCCATTTCGTACAGGACTCCATTGCTAACGC
AGTGGAACTTACAGAAACGGACGCTGATAAACATGGAAGAGCAAAAATCCTTTTATTTTAATGTTAAAGACTTAGTCCTTATGTTAACGGTTAATCTACC
TAAGCACGTAGTAACTAATGTGGGTAGTAGTAAATTAATACCCAAGTACATCGGCCCGTTTCGTGTATTAAATCGCCAAGGCAATGCGTACACGATCAAG
TTGCCTCGCAGGATGCGTACGCGTCCTACGTTTTATGTCGGTCGTCT