Description :
From Genome Similarity Track
Location :
Scaffold_737:7845- 9679
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_737-snap-gene-0.10Malonyl-CoA decarboxylase (MCD)

Sequence
1834 bases(100 bases per row)
AGACTTTGTGCCGCGCGTGGTGATCGCGAACCTCTGCGCCAAGTACCGGCAGCTCAACATCGAGGAGAAGAAGCAGTTCCTGCTCATCCTGGCGCGCGAC
CTGCACGTTGACACCGCTGTGGTATGTGTGATATGGATGTGTGTCTTGTAACATGTTTTATTATTTTAGGACAGATCCTAAAGTGTTGCTTATGCTGCTG
ACGATTCAAGCTCCAGCAAAGCCTCGAGTTTTTCAGCGAGAGCGTCGCGCGCGTGCAGCAGAAAGACAATGCGAGTGCGATCGACTGGCAACATGAGAAC
ATTGAGCGCTACCTGCGCACGTTCCGCAACTTACGCCAGGCGCTCAGTCCACTCTACGAGACGTTCTTCCAGCAGATCCTGTCGCAGCGTGAGGGTGGCA
TGCTCTTCCTCGTCCATCTGCGCGCTGACTTGCTGCAGGTGCTGCGGAAGCACACATCCGAGAGTGCTGAGGCCGCGGCTTTGCGGTCGCTGGACGTCAG
TCTCAAGGTGGGTGGCTGTTAACCTGAGCTGTTGTATGTTGGCTCGGAACATAATAACAACAATGTTGCCTGCTGTTGGTTGTGTGGATAGAATTTTCTG
GCCTCATGGTTCAGCGTGGGCTTCTTGAACCTCGAGCGCGTCACGTACGAGAAGTCGTCGGGCCAGCTGCTGGAGAAGATCATCCGGTATGAGGCTGTGC
ACCCTGTCGGGACGATCATCGAGCTCAAGAGGCGGCTGGGTACGATTCTCCTTGGAGGGAAGGAGCTGTTCTTTAGCTGCTCAGTCGTATTGAACTTGTG
TCTGTGGTGTGGGCTTTGACAGGCAAAGGACGGCGCTGCTTTGCATTCTTCCACCCCAGGTACATGTAAATTGCCCAGTATCGTATGGCCAATAGTTCGG
CTAACAAATTCTGACATTTCTTTGTTAGTGTCCCAGACGAGCCGCTCGTGTTCGTCCACGTCGCGCTGGTGAAGGAGATCGCGTCGAGCATGCAGTACAT
CCGCGACGAGACGGAGCTCATGGACGACGAGCACGACGCGAAGGCTGCGATCTTTTACTCAATCTCGTCCACGCAAAAGGGGCTTCAGGTATGTGTGGAA
ATTGGTTGTCTGTCATACAAATTGTGGATGACCTGGCTCATTCTAACTTGAGTCGTGTCTATGGAAATCAGGGCGTTGACCTGGGCAACTTTCTCATCAA
GGAAGTCGCGAAGGCGCTTAAGGCCGAGCACCACCAGCTCGACACGTTTGCGACGCTGAGTCCGATCCCACAGTTTGTCCCGTGGCTTGAAACTCAGCGC
AACAGTGTTGATGCCACGCTCGTAAGTGAGGCTCGCCTGGCAAAGCTCCAGTCGGCACTTTCTAACCACCACCAAGGAGCAGCAGCTCAGTCGCTGTTAG
TGAACCAGGTTCTGAGCGCACTCGCGATCGAAAACTGGTTTGAAGACGCCGAGCTGAGCGCCGCACTCAAGCCGATCCTGTTGAAACTGGGCGCGCACTA
CATTTTTTTGGAGAAGAAACGCGGCAAGGCGCTCTGTCCCGTGTCCAACTTCCACATCCGCAATGGCGCGATCTTCGAGCGCATCAACTGGCTCGCAGAC
CCGTCGCCAAAGGTGAGAAGCCTGCATATCAGCTATTGAAATTCTCTTGATTTCGGTTGCTTGGAAATGATGATTCTTAACATTGTCGAGCGACCATTTT
CATGATATTGTAACAGGGCCTCCACCAAAGCGCCGGCATGATGGTGAACTACAAGTACGACCTTAAGCAAGTGGAGGCGAACAACGAGAACTACTTGCTG
CAAAACATCATCCCGATCGGCGCGCAGCCGCAGC