Description :
From Genome Similarity Track
Location :
contig_25:784132- 785604
Transcript NameFunction/comments
g5046.t1conserved hypothetical protein

Sequence
1472 bases(100 bases per row)
CAACGCCACCGAGCGACGGGAAGGCGTCCTTGTCGCTGGCGTTGAACTTCTTGTTCTTGTTGCTCTTCTTCTTGGGAGACGAAGCCTTGGTCGGGGTGGT
AGCCTCAACGGCAGTCTCGGCGGTCTTCTCCGCCTTCGGGCGAGCCGTCTGCTCGCTGAACCAGACCTTCTTGGCCTTCACGGCAGCCAGCGACTCGGAC
ACAGCACCCACCGCCGACGGCGGCAGCAAACCGACGGAGCTGAAAGCCTCCATCTGCGCGAGCGGCAGGACCAGCTTGGCGGCCTTCTTGGTCTTCTTTC
CGCGGGCCTTCTTGCCCTTCTTGCCGGCGCCGAGCATCATGAAGTCCTCCTCCTTGCGCTGGCAGGGGCTTCATGCCGTCGAGCTCCACGGGGGCGGCCG
CGGTCTCGGCCTTGTCGACCTGCTCGTCCTTGAGCTCCTTGCCGTACGTCTTCTCCAAGAAACTCACGAGGGCGTCGCACAGGTCCATCTCGTTCTGGAA
GGGGTGGATCTTGGCCATCTCCTTCTCGTAGTCAGCGAGCTTGGCCTCGTACTCGGCCTTGCGGCCTTCCTCCTCCTTCTGGCGCTCGAGGTCCTTCTTC
TTGCGCACGAGGCGGATGTTGTTGTAGTACTTGTCGTTGGCCTCCTTGAAGTCCTTGCGCAGGGCCTTGATGGCCGTGAACTTGTCGTCCAGCTGCTCCT
TAATCTCCTTGCGTTCCTTGGCGAGCACGGGGAACTGGTCCTTCTGGTTCTCCTCCTCGTTGAGGCGGTAGAGCTCGTCGAGCGCGGCCTTCTGCGCGTT
CAGCTTTTCCTGCACCGCGTCGATTTCCTCGTTCTTCTGGGCCTGCAGCGCACGCGTCTCCTTGATGCTCTCGTTCTGCTGGTCCAGGACGCCCTGGTCA
CCCGAGACGGCGCTCACCTGGAGCTTCTGGGCCTGCAGCTGCTCGATTTCCTTGATCACGCGCTTCTCCTCGTTGAGCGACATGGAGCTCGTCTCCTGCT
TGTGTCGCAGATCGGCGATGGCCTGTTCGAACTCGAGCTCTGAGCCAAACTTGAGCGTGGCGCGCACGCTGCGCTGCTGCTTGACGGACGCGTCCTTGGC
GTCGCGCGTCTGGCGCAGACGGGCCGTGATCTGGTTGCGCTGCTGGATCAGGTCGTCCTTCTGGCCGCGCAGGGCCGAGAATTGCGCCTTGGCCTCCTGG
ATCTGGCCGCCGTAGCCGCCGCGGTTCGTCTTGAGCGCGTCCATCTCGGCGCGGATCACGTTCGTGCGCGCCTGCAGCTTCTTGATAGCGGCATCCAGCA
CCGAGATCTTGGCCTCGTGCTCGGCCTTGTCGGGCTTGGGCAGGCGCTCGATCACGTCCGGGATCTCGAGCTCCTGTGGCTGCTCGGCGACGACGGCGGG
GACTCTTCACTACTCATCGTATGCGGCTTAGGATGACACGTACAGTCTCTCTATGAGGGGGATTTTGACTGG