Description :
From Genome Similarity Track
Location :
contig_65:78408- 79646
Sequence
1238 bases(100 bases per row)
AGCCCCAGGCCACCAGCTTGCTTGGGTAAATATACGATCGCCGGATTGAGCTTGTGACGTGCTGATTCCGCTGACGTTGCATGGTGCCACAGGAATTGCT
TCTGTAGGTTCTGGAGTTGCTTTTCCGCCCAGTCCGGAGGTTCGAAGGCTGCTGCTGTGAATAGCACGGCTGGAAGCATGATTACATTTAGGATCAGGAC
CCTGAGTTCGACGCTGGTGGCCAGATTTGTTGCCGTGGCCAATCGCCTCTGCACATTCCTGATTCGAATCGCCCAATTTGGATCCGTTAGCTCGCCCGTC
CCGACCGCGAACCCTAGATACCGAACTGTTTCTCCATGCTGAAGCACCGGGATCTCCTGGTACTTTTTCAGCTTCACTGTTGTGTTCAAGAAGATGAGCT
TGCTCTTGGTTGGCTGAATCCGGAGGCCTGAGAGTCGGCCAAAGACGTCGACTATTTCCATGACCCTCGTTAGCATACTGGCCTTTTCCAGGAAAACTGT
TGAGTCATCTACAAACGCCGAGAACGTGTGCTCGGCTGCCGGTGTTCCTGGAACTCGGAGGCCTTTGATTTGCTTGTCCTGTTGGATTGCTAACGCTAAT
ATTTCTGCCGCTAGTAGAAACAGAAGTGGTGCGAGTGGACACCCTTGCCTGATACCGGATACGATGTCGAGTGGCTCGGATAGGCTGCCGTTAATCAAAA
ATCGTGCTGTCGTTCCTTGATGTAACTTCCTGATCATTACTCCGAACGCGTTCGAGAATCCGAACTTTTCCAGTACTAGGAAGAGGAATGCTCTGGCCAC
TGTATCGTAGGCCTTCTTAAAATCGAGCATCAGGATCACTCTGCTCTCCAGTGCTGCTAGGTCGGGTTCTTGTTTTGCGGTTGTTAGCATTGCGAGCATC
ATCATGACCGTTTTCATCATTTGTCTGCCATGCACGAAGCCTTGCTGTGACTCCCAATTGTACGTCCCATCACCTTTTGAACCCGGGATGCTATGATCTT
CGTGTAAACCTTATACCCGGTTTGGAGGAGAGAAATTGGTCTGTAATCCATCGCGTTGTCCGAGTCTCCTTTCTTCCTCAAGGGAATGATGAGCCCTTCG
AGGAAGGATTTTGGTGGTTCTCCTCCTTTTAGGAGCTCATTGCCGATAGCCACCATAGCTGGCACGAGAAGCGCCTGGGCGTCTTTGAACAGATCGTTGT
TGAGGCCATCCGGGCCCGCTGCTTTATACCTGTTCAAC