Description :
From Genome Similarity Track
Location :
Scaffold_973:784- 2058
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_973-snap-gene-0.6Serine protease family S10
Pytir_DAOMBR486maker-pir_contig_973-snap-gene-0.5Serine protease family S10

Sequence
1274 bases(100 bases per row)
TTTGTTTGTGGTGACACGAAGAAGCAGGACGCTGGGTATGTCACGCTCCCTAACAAGAAGGACGGCCGCTGCTTCTACTGATTCTTCGAGTCGCGCAGAA
GCCCGGTCAGCGACCCACTCGTAGTCTGGCTCCAGGGCGGACTGGAGTACTCCAGTCTGGCAGGACTCTTCACAGAGAATGGGCCATGTCACGTGCTCCC
GAACCTGTCGACCACACTCAATCCGTACTCATAGACAAATGAAGTGAATGTGATCTGGCTCGACCAGCCAACCGACGCGGGCTACTCCTATGGACTAGAC
GAGGACCTCGACCATAGCGAAGACGACGTGCGAGAAAGCATCTTCTGGTTCCTGCAGGGCTTTCTAGACAAGCACCCCGAGCTCATCGGCCGCCCGCTGT
TCCTAGCGAGGGAGAGCTACGCCGACCACTACGTCCCTGCTGCAGCACACTACATCTGGCAACAGCAGTAGCTGGAGAACAAGACTAGTACGACTGTGCA
TCCGCTCAACTTGCAGGGAATTGCGATCGGCAACGCGCTTGTGAACCTCGTTGCGCAAACCGCGCATGTGCTCAACAGGCCAACAACTCGTACAGCGTTA
CAGTCATGAACGCCTCTGAGATGGCGGCTGCCCAAGTCGCGTTGCCAACGTGCGTCGAGCTGCTTAAGAGATGCCAGCTCAACGCCAGTGCTTGCACCGA
AGCGCTTGCGTTCTGCGCAGAGAGGCGCTTGGCTCCTCTTAGAGCGCCAAACCGGAACCGATACGACATCCGCATGGAGTACGAGTAAGCAGAGCTACGA
CATGAGCTTCGTGACTGCGTACCTGGACTCTGCCACTGTGCACGCGCACCTGAACGTAGCTGAAGACCAAGCGACTACAAAGCAATGGGAGGAGTGCACT
CCAAAGGTCGGCGTAGGCTTCGCGCTGGACATGATGAAGCCACTCGACAGCTACGTCACTGACTTACTCGACAACAACGACATTCGAGTGCTGATGTACG
CCGGCGACGCTGATTTCGTGTGCAACTGGCATGGCTGTCTGGCGTGGATGTTGGCGTTCGACTGGCAGCACAAAGACCAGTTCAACGCCTCAGAGGAGCG
CGCGTTCGTGGTGACCCAAGCCGCCAATAAGAATGCCAAAGAAGAAACCACAACGAATGCTGGCACTGTGCGCGCTCTCAAGACCAAACTGACGTTTGTT
CGCGTGTTCAACTCGGGCCACATGATGCCGCGCGACCAGCCTGCTGTTGCGTCCGAGATGCTTAACCGCTTCTT