Description :
From Genome Similarity Track
Location :
Scaffold_3824:784- 1991
Sequence
1207 bases(100 bases per row)
AGTGATCACGGTGATCACAGTCCCAGGACCTCTGTGCGCTCTGAGAGTCCGGCCGTTAAGGCTAAGGGCGCTCCCAAAGCCGGTGGCGATGAGGAAGAGA
ATCCTCGCAAACGTCTCTCGCTTGCCGAGGGTCTTGCGCGCGCTAAGGCCTCTAAAGCCGAAGGCGCCAAGCCCTCAAAGAAGCGTACCGCCTCTAAGTC
TCCACTCCGCGAGGAGAAGGAGACTCGACGCTCCTATCAGAGTCTCTTCGGCTCCTCGGATGAAGAGGAGGAGAAGGAGGAAGAAGAGGAAGAGGAGGGT
GCCATTTGTTGAGCCCGGGAGGTCTCGAATGACCTCGACCAGCAGCAGGAGGATTTCCAAGCTGCCCAGCGTGTGCGTGGGGGTTCGGTGCCGCACCCGT
CAACCAGGGAGCTGCCATCAACTCAAGAGGGTATTGGCCTCCCGAGGAGAGCTCTGGGGCTGACCTCTTCTTAGAGCTTCTCGTCGCTCCTCGTGGCCTT
GTGGGCGGCCACACTTCTAGGGGCATCTATGAACGAGCCCCTTGTTCAGAAAGAACAGTTGTTCGTCGACAACTTGGAGGCTGCTCGGTGTGTGCTTCTC
GCGCCACACCGCATTCCCCTTAAGGACTTCACGACTTGTCGTAAGAAGCCCGAGACCCGGGGTGGTCTCTATCCTGTTTGGGGATACCCCTGGGTTATGC
CCGAGAACTGTCCCACATGGAGTTCTTGTGAGGACATGTTCTGGGCGTGGGTGGAGACTCTCAAGTACTCGCCCACGGAGTTATGGGAATTCCATGAAGA
TCAGCAGCTGTCCCACATCCTGGACCAGCGTGATCTTCGTGTGAGGTTTGCCCACTTGATTAGCAAGCGTATGCTGCCAAGGGACATCCTGAAGCGCGCG
GCTTCTAGCGCTCATGATGAGCGCGGGTACGGTATGTATTCATCATCCGTACCCCGTTCGGGCAAGAAGCCCCGGACTACTTATGAAGCTGCCGCCGCTT
CTGTTCCCAGATTGCGACAGCCTTCGGGTAGTCAATCAGGAGCCGTTCAATCGGCTCCCACGAGTTCTCGGAGTGGGCATAACCCCTCCACTTCACGAGG
AGCTGTCGCTTCCCGCGACACCGTTGCTCCTGGAGGATCCGCTCCACGTGGAAGTGGACTTCTTCATTCCGGTCAAGCAGGGGCGGAGGTGCCCTCGTAC
GAGTACG