Description :
From Genome Similarity Track
Location :
contig_65:78398- 79637
Transcript NameFunction/comments
g11210.t1POM75503.1 Hypothetical protein PHPALM_7388 [Phytophthora palmivora var. palmivora

Sequence
1239 bases(100 bases per row)
AGCCCCAGGCCACCAGCTTGCTTGGGTAAATATACGATCGCCGGATTGAGCTTGTGACGTGCTGATTCCGCTGACGTTGCATGGTGCCACAGGAATTGCT
TCTGTAGGTTCTGGAGTTGCTTTTCCGCCCAGTCCGGAGGTTCGAAGGCTGCTGCTGTGAATAGCACGGCTGGAAGCATGATTACATTTAGGATCAGGAC
CCTGAGTTCGACGCTGGTGGCCAGATTTGTTGCCGTGGCCAATCGCCTCTGCACATTCCTGATTCGAATCGCCCAATTTGGATCCGTTAGCTCGCCCGTC
CCGACCGCGAACCCTAGATACCGAACTGTTTCTCCATGCTGAAGCACCGGGATCTCCTGGTACTTTTTCAGCTTCACTGTTGTGTTCAAGAAGATGAGCT
TGCTCTTGGTTGGCTGAATCCGGAGGCCTGAGAGTCGGCCAAAGACGTCGACTATTTCCATGACCCTCGTTAGCATACTGGCCTTTTCCAGGAAAACTGT
TGAGTCATCTACAAACGCCGAGAACGTGTGCTCGGCTGCCGGTGTTCCTGGAACTCGGAGGCCTTTGATTTGCTTGTCCTGTTGGATTGCTAACGCTAAT
ATTTCTGCCGCTAGTAGAAACAGAAGTGGTGCGAGTGGACACCCTTGCCTGATACCGGATACGATGTCGAGTGGCTCGGATAGGCTGCCGTTAATCAAAA
ATCGTGCTGTCGTTCCTTGATGTAACTTCCTGATCATTACTCCGAACGCGTTCGAGAATCCGAACTTTTCCAGTACTAGGAAGAGGAATGCTCTGGCCAC
TGTATCGTAGGCCTTCTTAAAATCGAGCATCAGGATCACTCTGCTCTCCAGTGCTGCTAGGTCGGGTTCTTGTTTTGCGGTTGTTAGCATTGCGAGCATC
ATCATGACCGTTTTCATCATTTGTCTGCCATGCACGAAGCCTTGCTGTGACTCCCCAATTGTACGTCCCATAACCTTTTGAACCCGGGATGCTATGATCT
TCGTGTAAACCTTATACCCGGTTTGGAGGAGAGAAATTGGTCTGTAATCCATCGCGTTGTCCGAGTCTCCTTTCTTCCTCAAGGGAATGATGAGCCCTTC
GAGGAAGGATTTTGGTGGTTCTCCTCCTTTTAGGAGCTCATTGCCGATAGCCACCATAGCTGGCACGAGAAGCGCCTGGGCGTCTTTGAACAGATCGTTG
TTGAGGCCATCCGGGCCCGCTGCTTTATGCCTGTTCAAC