Description :
From Genome Similarity Track
Location :
contig_5:7838- 9386
Transcript NameFunction/comments
g1603.t1hypothetical protein

Sequence
1548 bases(100 bases per row)
GTGCACGTCTATGCAAGGATACCATATGCGATGGGAAATTTACGTTGGGGGCCGTGGTTTTTGTGGTGTTTCATTGGATCGTTTGGACCAATCACTGAAG
AGGAGTCGAATCTGCCCAATCAGGTACATGCCGACGCAGTACCGTGTCTTCGTAAAAGGAGGCAAAATGCCTCCTTTTACAAGGGCCCTACCGCAAAATG
TAACTACAGGTGTCGTGTTGTCTGACTGCGTACTTAGCTGGAGAGCCCATCACCACCTCAAAAGGAGGCATTTTGCCTCCTTCTACAAACCAGTATCTTA
ACTTTGTATAGTATAGTTAAGGTAGGTGGCTCACGAAAGGGTTAACCCCCCTACGCCCACACGTTGTATTTGACAACATGAATCATGTTGTACGTACAAC
ATGTTTGAATAGGGGTTGGCTCGGAAAACGGCTAAGTATAGTGAACTCAAATTTAATCAAATCCTGACAAAGCCGAGACTTTCCCGCAAATGCACAGGGG
TAGGCATAAACCGCTCATAAACGAAACTGGCATCGGTAGATGGCTGGTGTTCATTTGAAGAAAAATAAAAAGAACGCAAGAAAGCAGGAGACGCATGGCG
AGGAATAAGGCCCGGCGAGAATCCCGAGCTCAGCACCAGCGCGTTCTGGAACGTCTGGGTGGTCGTAACCCAGAGGAGCGGCAGCATCTTGTGAAGGAAC
ATGCTGCCTATTTGGCCGGAGAGCGCGACACCGACGTTGACTTCAGGGACGACAACCAGGCGCCATCAGCGGCTGAAGAGCCGCGCACTGCCCCCCGCAA
GACCTGGAAACCTCCGGCAAGACCTCCGACGGGTAAGGACGTTTCTTACCTTAGGGCCCAGAAGCGTCTAGTCTCCGAGCAGCGCCGAGCTGTTGCCGCG
AAGACGTCCGCTGGCTCTGGAAAGAAACTGGCTGTCACGAGAACTACCAAGGACGACGACAGCGAGTTTAATCCCGACGAAGTAGATGATGATGACGACG
AGGAAGTGGAGGAGATGGATGTCGACAGTGTTGAGAAGGAGACGGAATCGAGGGCGGCGAAAAGGAAGGCAAAGCCTGTGGCATCGACGACAGCGAAGAA
GAAGGCAAAAAGCAGCACCAACCCTCGAGGGAAAAGTGGTAAAGGTATGTCATGTTTGATGTTGTATGATACAGCAAGTACTTACAACTAGCTCATACTG
GATGAAATGCAGGTGCAGCAAAGCCTCGAAAGCCAAGTGCTGCCCGCGTGGCCAAGGAGAAGGAAGAGAAAAAGGCAGCAGCTAAGAGTCGGTGTGCAGC
CACTGCAGCTGCCGAAGAAGCGGGTGCTGCAGCGCACGAGGATGCGAGAACAAAACTGGACAAGAATTCTCCAGCTGCGAAGAGGCGTCAGAAGAACGTA
AGTGTCGCGGTGGTGCCGAAATGTAGCGGGGCTACACATTCGGTTCACCTCCTACCTTAGTGCAACATGCACTAAGGGATACATTCAGGTGACCACCACA
GGGTGGTCCACATTCATAGCAAAAGGCATATGACTGGTAGAAAGTAAC