Description :
From Genome Similarity Track
Location :
Scaffold_210:78379- 81085
Sequence
2706 bases(100 bases per row)
TATCTACCTATAAATATACTCAGTTTACATTCTACCTAAAATTGGTCACTTCGCTCCCTTTAATTAAAGAGGGGACCTGTGAACTGCCGTTCACTGAGAG
TTTGTATACTCTCGGAAGATAACTTCCTCTAGCGCAAGGTGCTGTGTGACCCCGTCACACTTGGTAGCACTTGTAGTCAATTCACGCCACCGCGGGTAGA
CTACCTGAACCTCTCCGAAGTTCGTTGCCATGAATAGGAGCGACTTCTCCCATATGAACGACTCTCAGTTCGAGTCGGTTCGGAAGATGGCAGGCATCTT
CCGGATGGAGGCCCTGCAGAGCCTGGTGGTATCAACACCGGCTGAGCAGCTCGAGCGCGTCAATGGATTCGACGCGTACGAGCAGGGCCTCATCGCGCAT
GTGCGGAAGAACCTGCAGGCGCCGGCGGCGGAAGCAAATCCGCCTCACCCGAAGCCAATACGGCTGAAGGTTAAGCCGTATGAAGGGAAGGAAGGCGAGA
ACCTTCACTTCTGGGTCCGAGAAGTAGAGCTCGCGATGGACGCGGCTCTGATCTCGACCAAGCAACTGCGTGTTGCTTTTGCACTCTCCAACCTTAGCGG
TCGTGCTAAGAGTTAGGTGTACACTCGGGAAGCAACATCCCCTGGATGTTTCGCATCCTGGACTCAGCTGTGCGAACAGCTCCGAGCCGCGTTCCTCCCG
GCGAACTACGAGTACCGCCAGCGTTCGCGCTTCCTCGCGTGTAAACAAGGAAGGCGCGAACTGCACGAGTATGTGCAAGAGATACGGGAGCTCACGGCGT
CCCTAGTGGGAAACCCACTCAACGAACACATCAAGATGACTGTGTTCATGGACGGCCTTCGAGTGGGCCCCGCACGCACTCAGCTGTTCCGGGTGCAGTC
AAGCACCCTTGAAGAGGCGATTCAAGTGGCTCTTCAAGAAGAGTACAACATCACTGGGCGCGTGCGCCGGCCTCAGAATGGCTTGGGAGTTCTTTGTCGA
CTCCCGGTCGAACGATCCCCAACGGACCAGTTCCCATGGAACTCGGGTCCGCCGAGCAGCGTGACATCCGCTGCTTCGGCTGCGGGAAGATCGGCCACTT
CAAGCGCGACTGTCCCGCGGAAAGACTCCGCAGACGGTCCTTCCCCAAGCCCGTCCTCAAGGGTCGCTGGCCAGAAGCCAGGATCCCGGGGACAGGGGAA
CGCCGGGAACCAGTAGGAGCGGGGAGCCCTACTGGGGAAGAACTACGTCTTCGTGATGGGTGCGCGGGTGGTGCGTACCACGGGGACTTAGCCCCTGAGA
GTCTTCGCACTCTCGAATCGGCGAAGCGCAGCGGCGGGTTGCTCGTAGTACACGGATGTGTACGGGGATACGATCATCCCTTTAGAATCTTGGTCGATTC
TGGGGCGTCAAAGAATTTGGCACGCCGCCAGACGGTTGCTCGTAATAGCAGCAAGTTGTCCGATGCTTTGAGAGAAAGCAAGGGCAACGGGACGGTGTCA
GTGCGACTGGCCGACGGGAAGGTCGTCACTGTCCCCAACGTCCAAGTGGATCTGGCCGTCAAGTTTGAAGACTTTGACAGCCTCGAACAGTTCACTGCTC
TCGATATGGATCCATATGATATGATCCTGGGTATGCCCTGGCTTGAGAAGCACGAGCCCTGGATTGACTGGCGAGGCAAGGCAATCGGTGCCAGCCGCCC
TGCGCAGTCCGACAGAGCATTGGTGAGTCATGTTCCCACCTCTGTCAGGACCCGGGGCGCCCGCAAGGGTTGCCAGGGTACCAAAGCATTCGGCAGATGC
TTGGGCGTCGTCGACGTATAAGACGACTCCGAGGATGTTTTGATGGTGGCAGCGCCCCGAGGAGGCGCTGACCAAGTGGGTAACTTAGGTCCACAGGCGG
GTAACTTAGTTCCGCAGACAGCTGCAGCTGTGATGAACACTGAGAACAGCGTGTTCAGAGTGGGTAACCGAGTTCCACTTACGGTCGCCCAGACCTTAAC
TGAAGAGGAAGACGTCGGATACGCTTCCTGTGTGGGTAACAAAGTGCCACACGCGGTCGCCCAGACCTTAACTGAAGAGGAAGGCGTCGAACACGCTTCC
TGGGTGGGTACCATAGTACCACACGAGGCCACGAGTGCCTCGGATGTCGTAGCGACGACATCCCTAGACGTGGGCAGCATAGCTCCCCGTCACAGACGCC
GTCGGCAAAGACGCCGCCGCCGCCTCAAGTCGGATCCGAACTTCGTTCCGATCAACGTCGCTTCAAGCGACTCGGAGTCCAGGGCTCGGGCTCCTCCGAC
AAGGCCGGTGGAAGAGTGTTATCACATCTTCGATGGCGAGACCGGTTTACCCGTCAAGGCATCTGGTGTCCACTTGGAACCGTTGCCACAGGTTGCAGAG
ATACTGCACCTCGAGGAAATGACGGTCGAGTCTTTCCTGGCCAGCCTCAAGTCTGAAAAGGTTGCCGAGATGGTACTCATGAGACCTGAGACCCCTCGGG
AGGAGCTGAACTCCTCCTCTGTCTTGGACGAGGACGTCCTGGAAGACCTGAACAAGCAGAGTTATACGCGCTTGGGTTATGAGATCCTTAAGAACCCCAA
GGATCCGGTGTATCCTTTGGTGACGGAGTATGCGGACGTGGTGAACAAACACCCACCGACCCAACTCCCACCAGATCGAGGCGTACGGCATGAGATTGAT
CTTGTG