Description :
From Genome Similarity Track
Location :
Scaffold_1177:7837- 10063
Transcript NameFunction/comments
Phyag_g9786hypothetical protein PHYSODRAFT_345966

Sequence
2226 bases(100 bases per row)
CAGGAACTTTTCGTGCGCCATTTTGTTCGGGAACGCGGCTCGCGTGATACGAATGGCTTCGACGACACCAGCGCAGCGTAGCTGATTAACAACAGCATCG
ATTTCGTAGATGTTTGGGCTCTTTTGCGAGTTAGGCTTGATGCAGCGTACGTAGTGCACTTCGGTGCTGGAAATGTCGCTCATCAATAGCGACAACTGCG
CCTTGAACTTGTAGCTCACGGTTTCTTGCATGAACGTGGACGTTTTCCTGCTAACTGTGCTGCGTCGACCTGACTCCATCATTGTTGCAGCGCGGACGGC
CAGATCGGCATCCGTCATGAATGccatgttgtcgtcgtcgccaaaaACCATCGACATCAAGTTATTTGAGCTCgtgcccagcagctccaacagaTCACTC
TGCAACGagtccttgttcttctcaACAAAACCTTCAGCGTCGTATGTCACAGGTCCCGCGTAGTGATGCAGCAGGAAGTGCGTTTGGCTGAGACGGGCTC
GTTCGAGTCGTGGGTGCGACTCGCGTAGTGACACCAGCTTCGACACGAACGACTGGTCGCTACCCATAGGACGCACACACTCTTCGTTGAGCAACGCCAT
CACGCCCATCGAGTTCTCCAACAGGTCCAACATATCTTGGTTGTCACGGTACTTCACAAATTCCCAAGCCacaccttcttgctggtACTCCTCCTGGACC
GTCTTGAATACATCCATTGTaaacttctgctgcagcttttcgtTTGCGAAGTTGATGCAGAactgctcgaagctgttgtGTTCGAACGATTCGAATCCGA
AGATATCGAGCAGATCAATGTGCAGATACGAAGGCGTTGAGGCACTTCTGTCGGCCGAATTCGAGATACTGTGGTTCACCCGGCGCACCAAGTAGCCGAA
AGCTCGCGCGTAGATTTCCTTTGCCAAAGCATCACGGTTGTTTCCTGCTTGGTGAGCAGACAGCGGCACGCAATACACTTCCTGTCGGGCCTTGACCGTG
CGACTGCAAAGTTGTTTGCTCAGTGCTGCCACTTCcacgccaagcagcttcgCACACTGCTcaatctccttcttctgctgctcgatcttctcAGCCGTGA
CGACATTAGacggcgacgcagcagcaacagcctgGCTCGCATCGTCCTTGTTCGACTCCAGCGGCACAAAATCGAGCTGACCAAGACGTAATATACCGCA
AAGAGCACTGAATAACTCGTTCTGCTCCTTGTCACTGAGTCCAATAGTCGTCAGCGCATCGCGCGTCACCTGGTACCGTTCCAGATCCGTCTTCCCGTCC
AGAACAAGCTTCTCATCTTGCAAATACCTGAACTCCTTGGGCGACGAGTGCTCACTAAACCCAAACGCGTTCTCTTTAGCACTCACCAACTGGTAGAAAA
TGTGGTAGTTCCGTTCTCCGGCCGCTTGCGCCACCACTCtcgacttctccagcaaATAGTGGCGACACTCCGCCCCCACGAGACAAAACTCTGCATtgaa
ctgcagctgcgtgAACTTGCCGAACCTACTGGAGTTGTCGTTGCGGATCGTCTTGGCATTGCCGAACGCTTCCAATAAAGGGTTACTTTtgagcaccttc
tccaccacaatCGTCTCCCCACTCTCGTTGGGGTGCAGTCCTTTCGCGATGCCCATTGAGATGCTGGCTAAATGCTCCATCATGAtcttcaccgtctccg
tcttgccaGCGCCCGACTCACCACTGACCAAGATGCTTTGAGGGTTtttgtgctgcttcatgtGGTGGAACGCTTCGGCGCTCGTCGCGTAAACATGAGG
AGGCATTTCGTCCCACGGTCTCTGGGTGTAGAGGTCCCGTAGCCCTTCGGAGTAGTGCTCCTTAATCCATTGGTACGGGTTCACAGCCACCACGATCTTG
CCCGTGTAAGTGTACGGCTCTTTGGCGAAAAATCGCTGTCTGACGTTGTACACGATGGCCGGTTCGTGCAAATGATTCAAGTTGCACATGTCTTCAGCTC
CGACGCCTTTGAGggagtggtggtggtcttcttcgttctgCAGTGGCAAGGAGTCGGGCATTCCGTCCTCGTTCAAGTCGATGGAGCGCTCTTCAGCTGG
GGTATCCTCATGATCTCCACTCTCTTGGTCGACTGGGGGCTGCACGCGCACGCGGAAGACTTTGCCCGAGGGATCCACGGACAGGACGGTGGCGGGCACC
cacacgagcttctcgtccgGGATGAA