Description :
From Genome Similarity Track
Location :
Scaffold_558:7836- 9577
Sequence
1741 bases(100 bases per row)
AGAAGTCCCGTACTGGTGATAAGGTCTAAGCCGACCGACGTAGAACGTAGGATGCGTGCGCATCTTATGTGGCAGTTCAATCGTGTATACGTTGCCTAAG
CGGCACAGTACACGAAATGGACCGATGAACTTGGGTAGTAACTATGTGTCAAGGTAAGTTTACCGTAGGTAGTAGGACTAGGTCACCTTCGTTGAATGAA
AGAACATTTGCCCTTCTATTCTTGTCAGCGTTTTTCTTTTGTCGGTCCACTGCTTCTGCAATGGAATCTTGCACGAAACCGACAACCATTTCGCGAGCCA
GTACGAATTCATCTGCTGACTCGCTGTCTTTGGCTGTAGTGCGCTTGGAGCGCATTGTGGCAAAATCAGTGACCTGGGTAGTAAGAGCATCTTCGCTCTT
ACTTTCCTCTTCTCCACCGAAGTCGATGTGATCGACATCGGCGTCATACGTAGCGACCTCGTGGTCAGTACGTGATGAGTGAGAGCCGAGTTGGCGTTCG
CTCGAATGATTCCCTCTCTCCCTCAAACTATAGTTACACTCCAAGAAGGTGGGTAGACTTGGGTGGCGCAAGCCATTCACGAAGAACGGTGTATGCGTCG
TCGATGCATGCACCGAGTTGTTGATGGCGAATTCCACCATTGGCAAGAATTCGCTCCAATTCGTAAACGAATGGACATAACCCCGAATGATTTCCTCAAG
AACGCGGTTTGCATGTTCTGTTTGACCATCTGTTTCAGGATGCTCAAAGGTCGGCATCTGAAGGCGAGTTCCGAGTGTTTTGAACACGAATTGCCAGAAT
TCAGCAGTGAACCGTGGGTCTCGGTCGGAGACGAGTTCACGAGGCAACCCATGAAGACGAAAGATCGTGTCAATAAAAACACGAGTGCATGCCGATGCAT
TGATAGATTCAGGTACAGCGACCAGGTGTACCATTTTACTGAATCTATCAACGAACACAATAATACCGGTATTCTTGTGTGGGTCTGCGGGGAATCCGAC
GACAAAGTCCATTGAGACAGATTCCCAGCATTCCGCCGGAATGGGCAAGGGTTGCAACGGCGCACGAAGTGAAGGGTCAGACTTCACTCGTTGACATACT
CCGCATGCGCGAACTTACTTTCGCACGAACTGATACCGGCGGGGCCAGCAAAATTCGCGACTAACTGTGAGATATGTCTTCTCTTGACCACGATGTCCAC
CAGTAGGTACATCGTGGACTCATACATGATGCTCAGTCGCAGGTCACCATGTTCCATTACAAGGACACGAGGCGTGTCGCCGGCAACGGCTGAATACTTC
AGTAAGCTATTGTGGACTGTATATCTATCTGTGGAGGATGGATATACTTGGGGTAACCCTTCAAGGGATTGACGGGATGGTTGAGAGAGATGATCCATCA
AGCGCACCATCGCCGGATCGTACGCCTTGCATGTGTCTTCGAATAAGGTTGACGACGGGACACTAGACGTCAACACAGCGACAGTGGTCGGACCAGTGTC
GGGTTGCGCAGCCGGTACGAAATGGGGCGGGCGCGACAGAGCATCAGCGATGACATTCAGTCGTCTGGCTTATATTCCACGGAGAAGTTATACTCCTCGA
AGAACGACAGCCACCTCGCCATCCGCTGCGAGAGGTGTGGACTATTTACGGCCGTACAGACGCATGGTCCATGTAAACGATGAAGGGTCTATCGCCTAGC
AGGTAGACCCTGAACTTCACCAAAGCATACTTCATGGCAAG