Description :
From Genome Similarity Track
Location :
Scaffold_273:7836- 8987
Transcript NameFunction/comments
g8698.t1hypothetical protein

Sequence
1151 bases(100 bases per row)
CCAGTAGGTCGCCCCGCACCGACTGGCCCCGTCCGTTTTTTGGCTGTGCGGCCGGAATCCTCTCGTCGGGCGTGACGTGCTTCATGTGGGCGAGGATCGG
AGCTGGCGCGCGGCACACCGCCGCGCGATGACCAGGCTTTCCGCAGCGGAAACAATTCAGCGAGAGGTCATTCTGACCACCGCGGCCTCTCCCAGAAGAC
GACCACCGTCGGTTCTGCGAAGCCTCGATCGCATCGATCTCCATTGGCTCGGGTACCGACACCCGAGTTTGTGCAGGCATCGTCTTGGCGTATGACGACG
TCACCAGGTAGTCCTCGCGTAGCGCGAGAGCGAAGGCTTCTTCCAACGTGGCAGGCTCGGCGCGCGTGAGACAGTACCGCGTCATACCTTCACACATACC
AAACACAAAGACATGGACTTGGGAAGCCATGTCGATCGGCTTCGTGACGATACACGATGCAAGGTGTCGCGTTCTCTGGACGTAGTCTCGCATGGCCATC
TTGCCTTGCTTTAGGGCGAAGAATGTAGCTCGAACGCGCGACTCATCTTGCGGTGGTTCGAAGGCGAGACGCAGGTCGCTCTGGAGTGCCTCTAGAGTCG
GGAACGCGTACTGGTCGACGACAAGTTTGCCGAGAGCCCATTCTTTGGCCTTTCCGGATAAACGGGATAGCAGGAAGTTCACCTTGGCTGATTGCGCCTC
GATTAGCCTCGAGGCGATCGCGATGTCGATCTCTCTGAACCAGCGATTCAGAGGTAGGCGATCAGGACCCTCGCCAGAATAGGAGGATGTCTCCATCTTG
ACGGCATTGTTCCTGGACGCATGCGAGGGAGTTGATACTCGCCGTTTTGCTTCGGCGAGCTCACTGTCCATGAACTCTTGGATGGCTTGGCGCTGTTGGT
CGGGGGTCGCTGAGCTCAGCAGCGACGTGACGACGGTTTCTCCGGACACCACCGCGAGGCGGTGCAACGCTTGCCACTCGATAGACGTGAGATGGGGGAA
GGCCGCGTGTTCCAGGGTCATCACTGGAGGTCCGGCGGGCTGGTCTTCACTCATCTCGAACTTAGTCATGGGAAGGACTACGAAGTGCTACCAGGTGCAA
CGGGCCAGGTGAGTGCCCGTCACTAGCTTACACTTAGCGGTGAGGAAGCGT