Description :
From Genome Similarity Track
Location :
Scaffold_176:78352- 79954
Transcript NameFunction/comments
g10684.t1RAW21100.1 hypothetical protein PC110_g22458 [Phytophthora cactorum

Sequence
1602 bases(100 bases per row)
CTGGGGCGACCAGGCCACGCTCGAGAACATCAAGATCAAGGGCAAGAAGGTGGACGTGTGCGCGTGGTCGCAGGGCTCCACGTCTGGCGAGCCCAAGAAG
CTGGGCGCCGGTCCCTCGGGGTCGCTCTGCCAGTACTCCACCAGCACCGTCTCCTACGCGTAAGCCGCCAGCGATCGCGGCAATGCAAACGGAGCCAACT
GAGACTTTCACTCTGCTCCGTCTCAGTGTGAGCGCTCGCACAAGTGGGTATGCGAGAGCTCTGTACATGTGTCCATCGACGTGAATGTGTCGTCCCGAGT
GTGAATCCAATAGAAAGCTAGATGTGTTTCCTCTTCATCCCAGTTTTGCCATTCCATCGTTGCTGCTGGTACACCTGCTTGGTTCGAGTTGTTGTCTTCA
GTTGCACCATCTCAACTAGAGACGCCATCTCACCGTCTTACCAGGGTGTGTGTGTACGCTCAGCAGGTGACTGTGCGTCAGTCAATTTGTAGACTTCCGG
CTCAGCGGCTGTGGGGTGGTCGGCTTGACATCGCAGACTGCGAGCACGGCGGGTTCGTGCCTTGACTGCAGTCACCGACGCAGAGGCACTTCATATTCGT
ACAATTTGCTGTTCGTTGAGCCGCACCAGTTGCGCCGTGCACCACAGATGGACACCGACTTCCATTCAACTGGTGGCAAAATGCCGGATCGACCGAGCAA
GATGCGGGTCTCAGCTGGCCGGTACTCTTGATAGAGGCCTGTCTTGATTGTGTACGGAGTCTAGATATGCATCCGTAGTCAGACAGAAGGGAGGCCGAAA
GCACTCCGCGGACCCAGCGCATGCCGGCAAAATTTTCAGCCGCGCTGTTATAGACCGCTGGTTTTCTAACAGGCTGGCTTTGGACCGCCTGGGTGGTGAG
CGGACTGACTGTGCGTTATTGTCAAGGAATGCACAGACGATCAGATCACTACGGATGACGGTCGACACCGACTGCTTGTTCGACGGACGCAAGTGTGTGA
TTTCGCGTCGGTGTTGGTTGGTTGCTTGCCACGCTCGTCCCAAGTCGCCCCGGGCAACACGACCCTTTCGCGAGGACCCGATGGCTGTTACTGCTAGGTC
ACGAGGCTTGAAGACAGGTTGCCTTTTCCGCGTCGCTCGTCGTTCCAAAATGGCAACACTGTATCGTTTAGTTCTTTTTAGTCGCTCGACCACCGCAGAT
TAGTCAAAGCAGCCTCCGATTTAGGATTTTGCAGTCAAGTTCGTTCGGTTGATCCTTGCGTACTAGGCGCGAGGAATGCTTTAACGCCCACAGTAGCATA
CACCCGTAGCATCCGTAGTTCGTTAAATCGACAAGAAGGGATCAAACAAGACTCGCTGCTCAGTCAACCAACCTCGCAGCGCGCTCGCAGTCATCCAATT
CATACCCAAGCATCCACACACTTGGTCGCGTCTATAAGCCAGCTGCTGCCACTGCAGTCGCTCAGCCCGACGCGCGTGGAAACGAACCGAAGCGGGTCGT
AGATGCATACTGACTCAGGACTCGGTGATCGGTGATCGGTGATCGGCGATCGGCGATCGAGCGACGGTGGTTCCGCTGTCCGTTCTCTTTGCTGTTTTGA
CA