Description :
From Genome Similarity Track
Location :
Scaffold_196:7834- 14729
Transcript NameFunction/comments
Phymu_g6513hypothetical protein PHYSODRAFT_492835
Phymu_g6514hypothetical protein

Sequence
6895 bases(100 bases per row)
GTCCACGATCGGAAACGGGTAGTCCTTGCCGATCAGGCAGCCGGCATCGCGCTGTACCTTCAACGGCGCCTTCCACGGTTCATGCACGAATTTAACCGGC
ATGTTACGGAGCGCTGGGATGTACTTGCGGATGAAATGGCCTTGCTGATCCCATCGCTGCGGGAACGTGGACGGCGACGCCACATGACGGtagttcgaga
agaagcagctcgcactTACCCAAAGCCAATTGCCAATGTTCATGGGCCAGTCCATGTCGATCAGTTTCTCCTGGAAGTaagcagctcctcgtagCCACGA
GATGTAGAGCACCCCGCGGgtcaagaagcaggcgacggcgTGACGTCCGGCGTGGTGCGTCCAGCCTTCCTGGTTGATCTGCCGCATCACAGCGTCGATC
CAAGGAAAACCGGTGCGTCCGTCCTTCCAGCACTGCAACTGGTGCatcgcgagcttctcgtctgCGTCCGACAGGGTAgcctgcttctgctggtcgtATT
CCGGGTGGGTTACGTGCTCTTCGTCCCGCAGTCTCCACTGAATCTGTTTACAGCCTGGATTCCGCTCCTGCGACGCGAAGTTCGGCGTGCCGCACGCGTA
GCAGTAGAAGAACTCGCGCCACATGAGCTGACCGTCAAGTGTGACTTGTGTGGGGCCTGGTCGGAGCGGGAACTGCAGCTGGATGAACATGATGCGGTAG
AAAAACTCCCGTGCGCTCAGACACCCGAAGCACAAGTACGCGCTCAGAGCCGTCGTCGAGGGCGCGTTGACAGTCACGGGCGacgtcttgggcttctcgA
ACAACCCAACGCGACGTTCATCCTTGCAGAATTCCTCCAGCCTTTTCAAAGCTTCGCTTTCTCCTCCAACAAGAGGCGCGTGAGGGTCTGGCAGCGCCAA
CCCGAACACCGTGAGGACCGGCACCACAAACAGCTCCGAGTCGGCACTTTCCGCGCCTCCGACGATGCTGTTCGCAGTGCTCGGGTCATGTTCACAGAAA
TCCTTCAGCAATTTGAACAATTGACTCGTACTCAGCGCTGCCGCGTTGTTTAAGTTCGCAGGCGCCCGTATCGGCTGCGCTGGCTGTGGCATGTTTTCCG
TGATCTCCAGTAGCCGCTCGTAGTCCGTAGGAGGCCTACCACCGTTCAATCGGATGATTTCATGGGGGTCGTACAGCGTCACACCTCGAACTGCCGTCAC
GTTGACGTTCAAAGCCCGCGCTATTGCCTTCACGCGGTCGTCGCGCTCCACCGCGTAGGACATGACGCCGGCCTCAAAGAAGAGGTCGGTGACTCCCCAC
GCCGCCATAACAATACGCAGCACTTCCTCCGCTTCCCCTCGAAGTACCAACAACCGtccgtgcagcttctcaaAGGATTTCGCCAGGTCTTCGATCGCTT
CGAGCAGGAACTGGAACCTCATGGGTCCACAGCGTTGACGCTTCGGCCGGTGCAGGATGTAAACGGGGAGCAGAGCCATGTCTCCTCTCTCGGACTTTTG
CTGCGCTCGGATCGCCGCGTCCAGCGCCAAGTTGTCGTGCAGTCTCAAGTCCCGACGGAACCAGACCAGCGCTCGTCGTTTTGGGAGCGTTGCGTCCACA
TTTGACTGCTTAACCTTATCCTGATCAGAGTTGTCCTCCTGGACGTTTGCAGCTAGCGCTTGCGCCTTCATTTCTCCTCCGTCCAGGACGTCCAGCATCG
ACGTCAAGGAGCTTGTCGTACTCATAATGGCCGGGTCATTACTATTGCCGTCTCGGATGAGTTCCGCCCAGTCGgtctcgtcgtcactggcctcctcctc
ctcctcctccgccatTTGGACAGCGTTTTCCACCGGAGtttcgagctgttgcagcgctgGAAAGTCGCCCGAGATCTCGTCATGCGTTGACACGCTGCGc
tgccgcttcttggccatttcAACCCGCAAACCCCCTCCACTGCTGACCGagagcttgctgcttggcgaaTGAGcacaaggaagagcttgcgAGCGACGAT
CCACTTCCCAACAAACGAAGCTGGAGCGCTCGACGAATTCGGTCGTGTTCAATTGAAATGGATCGGGCGCATAACGGTCGTAACTTAAGTCAAAGTATGA
CAAACACGAGGTTTTTCAATTTACGAGATGGAATTTCTATAGAAAGATTTTTATACCCATATTCGATAACGTAGGAATATAGAAGATAAGATTCGTGCGT
TTCTATTCCCAGTAGTGTCCATCCATTGTAGTCGCTCTAGGAAACGCCCGTCGACCAtcgaaatggctacatcaacttcaacttgatcttcagctgaagc
agtCGCGTAacaccagctgcagcatctcgtcggTCCCGAGAGTGGCGCGTACGTTGACGCAGTAGGcctcgaagtgctggaacgccacgacgccgtccCC
GTTGCCGCCTGCCACCTCGAAGCTCAGGGCGAAGTCCTGGAAGACTTGAGCGGCGGACGTGCGGCCCAGCACCGCGTCCGGGTGTTTCGCAGCTTGGAAA
CGTGACGCCAACGCCGCAGGGAACACGCGACCTTTGCCTGCCGTTTGCAGCGCCGTATATATCTGCGTTGCGCTCGCTAGACACGCGGGGCTGAGCCGTT
CGAGCAGAGAGCCCAGAACCAGTCGCAGTGGGAGCCGGTTGCTCGCGTTGTCATACCCGTTGACTCTGTGCTGCTGATTCAAAAACCGCCCGCCAATACT
GTTGCTCTCATCGCCGTTCGCTTGGGAAAGGTGTTCGAACAGCGCACGGCCTTGCGATTCCCCCAGAGACAGACCCAGAGCTGCGTTCAACGCGTCACAG
CAACGAGGATACGTGATGGTACCTGTTCGAGGATCGGATGCTTGATGGAGTCGAGAAcgaagctggacgacggcAGCCAGTGAGCCGCTCTGTCGAATAC
GGTAACGAATCGCATGAAGAACCGTATCTCCAGAGTAACTGGGCACGCTGTCAACCGCTGCAGGGGCGGCTCTTAACCGATTCGCATCGGCCACAGCTGC
ACCACTGGCAACGTCTTTCAACGACAAGATCTTCCTCTCCTTCATCAGTTGGACGGGAGTTTCTGACGCTGACGTAGATCGATCACCTGCCGCTGCTACG
GGCTGTGAAAAACTCCAGGAGGATGCTGTGCCGTTGCTTCGCCGTTGTTGGTtatcttgctgttgttgaggTTGCATCGCCGGCTCAGCATCCGTATCCG
ACTTGCTCCCGCCTCCAAGATGCCACACGTTGCAGATGATGTCTTCGAACTCCTTGTCGGACGCCATACTGGCGCTCACGTTGTGGTAGTAACCACGCCA
CTGGTCCCACGTCACCTTGCCCTCTTGAGCGCCACCGTCAATGTCAAACGTCTCGAGGAATTCCCGATACACGTGGTCAATTCCTCGTCGACCAGCCAAT
ACATCGGGGTGAGCACTGCCATCGAAACCTTCCACAACGTCGCTGGGTTCCAGTaagatcttctccatctcacGAGAATTTCTCGCTTTCGCAAGCTTGG
CAAAAGCCTCGCGGACGTACTCAAGCCGACGCCCAGTTAGCGCCGGTCGCACGATGTTGATCAGCTCTTCCGGTGCAACACggccgtcgccgtcgctgtc
aAGATACTGGAAGAGCAGTCGGAGATCCGCGTCGTTCAGTCCACCAGGCAACGTCAATTCACagtcggtggcagcagcacgaaggTCCTGGAGGTTCAGG
CTGTTGCctcttgcagctcgaagacgtcgatTCAGAGTGCAAAAGCCCGGCGAACCCTGtgtctgcagcaccagcttgaGGCGGGACAGAATCGCTTGCA
CTCCTGCAGGATGGAGGTGGAACTCGCGTCTACCGGGTGAAGTGAGACCCGACGAAGTCTCGACAGAAGCGTCGGGCTGTTGAGACGCGTGGGTTTTGCC
TAGACAAGCAGCAATTGAGTTGCTCACGTTGTTCCTCGCTCGTCGGAGCGTCATACTTGGACTGGAACCGGCGCCGGCTGGAGATTGACTGCTGTACGCG
GCCGAGTGATCCAGAACTTCGTACAAACTGGAGCGTCCCGGGTCTTGTCGCTGGATCCCTCGAAGTCTCTCCGTCGATGCGGGTGTACCGCCTACAGCAG
CAACCCGCCCGCCGTTACTAGGTCCAATGTGCCAGGCATTCCGAACCAATTGCTCGAACtggtcgtcttcgtcgattCCAGCGCTCACGTTTGCGTAGTA
GCGTTCCCAAACGTCAAAGTTCACATTGCGCTGACGCTGACGTTCAGTAACTAGTCCAAAGGTATCGAGAAACTCTGCGTGGGCCTCGCAGTCCGTCTTC
CTGCCTGTTAGAACCTCAGGCAGCCGTCGCGCATCAAACGTCGTagcaatagcagcagcagggaTTTCCCCACTGCTCGAGCGATCGAGAGCGTCGAAGG
CCATACGCACCACCAGCTGACGGCGAGGGTTCATGGGCTCGCGCACACCAGAGAGGAACTCACTTACACTCATCGTGCCGTCGTGGTTGCTGTCGAAGTG
GTAAAACAAACTCTGGGCGTCACGGCCAGTGATATGCACGCCGCTGCTCTTCAATGCCCGGACGAACTCGTGGAACGTGATGTTCCCATCGTTTAGTTCA
TCCGCGTACTCCTCCTCTGACCGTCCGGCCGCGCGGCGTAGCTGTTGTTGGAGCGTGATGAACCCACCAAGGCCTCGCTCCTTGAGCTCGCAACGGAGGG
AGTGGATCGTCCTCCGTAATTCCTTCGACTGCTTGCTACCAGTACCTGGAGATCCAGGCGGAGCCAACATCAAGGCACTCGTAGGACTGAGAACGCCCGA
CGGAGGCAAATGGTCTGCCAAATCTGGCTGCAGAATAGCAAAGGCCTGTTGACTGGCCATTCCTGGCCCTGAACTGCGTTTCCCACGCCAAGCAACTTCA
CCAGCACCGTTCGTTGGCGTGAACTGGCGTACTGGGTTCCCTGCAAAGGCGCTTCCCTGTGGACTCGCAGCGACAATTACTGGAGGTGCGCGTGTCTTGC
TAGCTTGGGGGCTCCCCGCCGGCAGTTGCCACGTATTGCGCACAATGAGCTCGAACAGGTCGTCGTCAGggacgaggaagctgacGTTGTGGTAGTACGC
TTCCCATTGTCGAGGGAGAATCTTCCCCTGAGCCTCTGAGCCTCCGCCATTCTCACCCATGTCGAAGTTCTCGACGAATTCTCGAAAGCATTGCTCCTCG
GTTTTCCGCTGAGCGATGACATCGGGATGGCGGTTGGCGTCGTATCGCTGAACGACATCGCAGGCGTCTAGCATTGTCGCTCCCGTGTCACGCGCTAACG
TCTGGTAAGCGGTACGAACCAGACGCAGTCGACGCGAACTCATGGTCCCTCGAAGCAGATCCAAAGCGGCTTCAACCGGCACCGCCCCCATTCGGTCCAC
ATCTAAATGCCGGAACAACCCACGCAGATCGGCGTCGCTAAGTGGCGCGTAGTTGGGAGTTGCTGCGCTTGTGACCTCGTGCGAGCTCTGTAGACCGCGA
CGGAACTCTCCCAGTGCCAGTTTTCCATCACCGTCTGCGTCGTTCAGACGTAGACAACGCCCGAGTTCGACAAGAGCCTGAATCCCCCTAGCACGCAGTC
CAGACTGCACCTTTCGCAGTACGGAAGCTGCTCCCGGGTCCAGAGTTTCAACGGATGGTCCAGTTCCCGAGCGAACGCTCGATACTGGTGACACGGGGGA
CGTGACCTCCGATAGACAAGCTGCAAATTGAGAACCTTTGAGGAATTCATTGGTGGTGTGCGTGGCAGTTCCGCGAGGCGAAGCATCCGGATCCATGGGC
GAGTAGCTCAGGGTAGAACGGTACTCCCGTGGggacgcagtggtggagatcgagaGCACCACTTTGGCCTTCGTGCTGGTGTTTtggttctgctgcagag
ccTGGTAGAGCGACACAGGGGCCACAGGTGCAGGTGCGGGCGGTGGGACCGAGTCCATTCGCGCGTTAAGGTCAGCAACCCCCGCGGCTTCTTGTAGCGA
GCACCGCGTATCCGCGTGCCACACGCGCTTCATCAGTAGCTCAAAGTACTCGTCGCTGGGCGCTTGAGCCGCCACACACTGGAAATACGTCAGCCACTGG
GCCCAGCTCACGAACGCCGTCCCCGTTCGACGTGCAGCGGTCATGAACGCAGTCTGGAACTCTCGAGCGGCCTGCTCTGCGGTCTGTTCGCCAAACATGA
CAGCCGGGTGGCGCGCGGCATCGTGCGCTGCCAACACGTCCGGAAGCGCCAGATACCCGACGCCTTTGCGGTCCAACGAGTCAAACGCAGACTGCACGAA
CTCGAGTTTCCTACCTGCCAATGGCCCCTACAAACATGTTTTTGTAAACTAAAAGACTAATAGCGGCATAAATGACGGAAAGTTACGTACGAAGATGAGG
TTTTTCATCTCGTCGGCTGTAACCTTCCCGTCGTCTTCAGTATTTTGATTGAATCGCTGGATTAAAGCTCGAGCATCCTGTAGAAGTTTTTTAACATCTC
AATTTCTTAGAACTCACTAGCTAAAAACAATCGAACAAGTCACAGCGTACCACATCCGAGATCGGCACTCGACAGTCATTTAGCAGGCGCTTGAGAGCTC
CGTTCGTGATTCCGCCACTTTCACTCTggaccttctccagcgccagacTGACGTTCACCCATGCACTTAAGACCAAAAATGAAAATGAAAATAAAACCGT
TAGAATAATTAGTGTTCAATTCATCTATATTTTCCATTGTTCCCCACTCACACCAGGCCTTGGGTACGCAGTGCCGTACGGACGCTATTcaagagcgact
gcaggTCCACCTGCCCTGcacactgctgctgccgctcctTCCACTGGGTCAGCGACGCCACGCCGCTCCCCGCAGCTTGTGCCGACAGCGCCATC