Description :
From Genome Similarity Track
Location :
Scaffold_138:78331- 83166
Transcript NameFunction/comments
g18590.t1hypothetical protein
g18591.t1XP_009513787.1 hypothetical protein PHYSODRAFT_536754 [Phytophthora sojae
g18592.t1RAW34127.1 hypothetical protein PC110_g9559 [Phytophthora cactorum
g18593.t1hypothetical protein

Sequence
4835 bases(100 bases per row)
GTGATTGGATGCCAGAACCGAGGGCGGACTATCGGCTGGAGAATGGCGGCGCCGTCCTTCTATGAGGTGCTGGGCGTGGCGGCGACGTGCAGCGCTGACG
ACGTTCGCCGCGCGTACCACCAGGCGGCTAGGAGATGCCACCCGGACAAGCGCTCGGCCGCGACGGAGGAGGACGAGCAGCGCTTCCTCCGTGTACAGGA
GGCCTACGAGACGCTGCGGACGGAGGAGCAGAGACGGCAGTACGATGCCAAGCTGCTGCAAGACGAGCTCGTGCGGAGGAGGGAGCAGGAGCTGGTCATG
GTGTCCGATGAGGTCCCACTTGCAGACATGAAGCGTGAGATCCTGCCGGGCGACGACGACGACGAGGTGCTCTTCACGCATCAGTGCCGCTGTGGTGATC
TGTACGAGATCACAGAGGATGAGCTACAGGACGGCGTGGACGTCGTACCCTGCACGGGCTGCTCACTGCACATTCGGGTGCTGCATGCGGTAACAAAACA
ATAGAAACAGTAAATGCCATGCCGGCCATGGGGAAATATAAACCTTTCATTTGCATGTTTCCTGTCCGCGATGCCCTTGCTCTCATTGCCAATCATACGA
ACCAGAAGCTGCCGCCTTAGAACTCCTTGCCGCGCGGCGCTCCGTGGGACGGGTATCTTTGCGGGGTCTGGATCTGGTGGAGCACGCCCAGACCAATGTA
GGCCATAAAAATGAACAGGAGACCGAAAAGCAGGCCCGCCATGATGTCGGGGGTGACGTTCACGTAGTGCGAGAAGCAGAAAGCCCTTCCAGCCGCGCTG
TACCCGATGAGGTAGCCCGCTTCACACAGAATCGCAGCTTCCGTCGACGAGTTCGCCTTGGCCTTGGTTTGAGCGGCAAGACGGCGAGCGAGAGGGTGCT
GAAGTTCGACCGAGTCCGCGTCGTTGCCCGTCAGAGCAAAGTCCGTCTTGCTACCAGTGGCTGAGTTCAGGCTGCTGGAGGCTGCCTGGATGGCGGCGTC
CACGTCAGGCAGCAGCATACTCTCAGGGAGCTGCACGATCAGCAGGTCCGTCTTGCCGTTGGAAAGGAGCGCCCGGCCTTCCTGAGAAGCAATAAACACA
GCCAGATCCTGGATTCCTACGATATGAGGCTTCGTACTGGCCATCTCGGGAAGAAGCGGCTTGGAGCGCGTCGTGTGAGGGATCACCACCGACGACCTGG
AGCTCTGGACGGCGTTCTGCACGAAGGAGCCCTGGCCGCCTCCTCTAGCGAGCTTCGATACATCCTCCGAGGCCAGCGACGGCAGCAGGAATAGACACAA
CACCTCTGCCTCTTGGAATGATGAGCCCTGAGCGCTCAGTAGACCCTGGAAATGCCACTTGTTAACAAAAAGGAAAATGACCTGTACACCACTAAAACCT
AGCGCACCTCCTTGTCAGCGCTGGCATCAAGCGTCAGCACGCGTCCCACGGCCGATGCCACAGCGGCTTCGTCCATCTCGGAGCTCAGGTAGGCGTTTGA
CCCAGCGAAGATCCTGCAGACAAAACTCTGTAAGATCCAGGGGTCGCTGTATAAAGTGCTGACAGGCAAAAGGAGAGGCGAACGCACGGACGCTGGGACC
ACATGACGAGCGGAACATGGGGGAACAGAGTGGAGGCCGAAACGGCTGACGTCGCAGCCGCGAGGCCGCACAGCGTGGCGCCCAGCAGCGTCTTCATCAT
CGTCTACTTTGTCTGCTACTTCTCCGCCGCTTTAGATCGCGCTCTGTCGGTTTCTGTTTTTACGGCTTGCTTGTAATTTATGGCTTGATTTCAGTATGAA
TATTCCTTAGGACATCTGATCTTCTGTGATTCACTTTAACCTGGGTTCAGTATGCCATTTCGTACTTTAAATAAAGGCCAGACTCTCCTTTTCCAGCGAT
TCGTGGCTCACTCCAAGAAACCCACAGGTAAGACGATTCGCGTGCTAGTCCCGGACGAGATCTCTGTCGCCCCCCCTGCGTCCGTGTTCGATGTGCTGAC
TACCGCTTCTCGTTGCTCTGTACGCAGCCCACTGCCGTGCAATCCCCCTCCCTCGAAGCCCAAGATGTCGTCCATCCTAGCGTCCCTCGACATGAGTCTG
GACGACCTCATCGCCCGCAAGAAAACCAAGCCCAGCAACCCGGCCTCGCGCCCGGCCAAGGCCAACAAGGACAAGGATCCCGCAACCGGTCCCATCCGCA
GCGGTCGCCGGCAGAACCGCGGCCGTAACCAGCCCTACTCGCGACCTGTAAGTGTTGACACGACGCTTCAGTCTATTTTCTCTCTATCTTTTCCGCCCTC
CTACGCTGCGGAATGGTAGCCCCCCCATCTCTTCGGCGGACAGATGTCCGAGCTCTCGCTCCGGGGAGCATGGCGCCTGCCTGTTCGCGTGCGTTGAGGA
CGGACGTTACGTTTGGTGCAGAAATTTACACGTGCAATTGTCTCCTGCGTGTACCAAAGCGCGGCGGTAATGACGACGATATGGACATTGACCTGGATGA
CGCCCCCGACAGCGGCAGCCGCGGTGGCAAGCAACGCTCGGTTGTTGTCAAGAAGCCCGGTAAGGGCGACAAGAAAGGTGCGACGCTGCTCCCTGCTGCG
CTAGCTGAGATGACCAAGATTTACTGACGCATGGTTGACGATTATCCTGCTGCATAGGCTCGTCCTCCATCCTGTCGCGTCTTGGCGGCAAGGATGCGGC
CGGCCCTGGCACGAAGATCCTGGTGAAGAACCTCAAGTTCGACATCCTGGAGGAGGAAGTGCGCGAGCTCTTCGGCACGGTGGGCAAGGTGTCCAAGGCT
GAGATCGTGTACGACCGTTCTGGTCGATCCAAGGGCATCGCTCGCGTGTGGTTCGCTCGCCGCTCGGATGCTGACAAGGCCATCAAGCAATACGACGGTA
AGTATTGTTATTTTGGTGTGTGTGGAATGTCTTTTCACGACGACTTAATGTGTTGTGCTGGCGTTGCGTGTATCGATCGGTAGGACGTACTTTGGACGGA
CAGCCGATGCAGATCGCGCTGGACGGTGACAAGAATGTTCGCAACGGACTTTTCGGCACGGCACTTGATCGTGACGACAAGGATGTCCGGTTCAAAGTCT
CGTTCGGGTATGTGAAACGCCTGCCGATTCGTAACATAGGAGTTGATCGTGGTGTCTGACATTCATGTTCGCAGTGCTAACAGTGGAAACAACGAAAACG
ATCAGTCGAAGGGCCGTCGCAACAGACGTCGTGGACGCGGCGGTCAGGGTGACAGAGGCAGCCAGGGCGAACGTGGCAGTCAAGGGTACGAAGCCATTTT
CGTGGGTTTTGCTGGTATGCTATTCTAAACGCAGTGATTTGTTCCTTTTTGTGCTGCAGCGGTCGTGGTAAGGATTTAGCTTCGTCCAAGACGGCTGAGG
ACCTCGACAACGAGATGGACACGTACATGAAGGACGCGTAAAGATGAGGCGTGGTGCATCCTGCAAAACGGGTGCTTGATGCGAATCTATACCGCGACTA
TGCATAGTTGTTCTGGTACATTGCATTTAACGGGTGTGCGTGTGGTGAGCAAGGGCTTGAGCTCGTCACCTGTCTGACAGATCTAGCGAGTCGTTTGACG
TGCCGCTGACACCTGAGATATTGAATAAAGCATCTCCATGACCATGAAAAACGGATCCCCGCCAAGGTGTGCCGCCAGCGCAGTGCAACGCGAACTACCA
AGAGTAATGTGCCGGCATGTTCCCGTTTTACTTCGTCTTTTCTGGATTGGTTGGTCAAGATCACGTCAAGAGTGCTGTGTTATCAAGCTTTGCACAACAC
GGTCTGTGTTGCACGACCGAGGTTTTCCAGTTCGCGGGAGTCGACAGGTCTTCTGTGGTACTGGTAGAATGTCACTGGTAGACGGTTGTAACTCACATAG
TGCCGGTGATGAATCCGTTGTGCTTTTTTTTTTAATAAATAGCGCAACTGAGTCGTGAACTTATCGAGCGAACGACGTTGACGAAGGCAAGATACACCAC
AAGCTGATTGGCCACCAGCAGACTTGACAAATACTACGATCAGGACGAGCATGCTGGGCATCGAGACGGAGGAAGAGCTGCATGGCTGGCTCGTCAAGGG
CGTTTTCGTGCTAGGCGTGGTTACATATATCGCGACGAGCTTTATCACTGCTCCGTACGGACGCCACGTTCGACCAGGATGGGGGCTGACGGTGAACACG
CGCCTCGGCTGGGTCCTGATGGAGAGCCCTTCGGCCGTTTGGTTTGCGATTGTGTACTCGTGGGGGGAGCACCGTCTTGAGACGACCCCCCTCATTGCGG
CGAGTCTGTGGGAGTGCCACTACGTCTACCGCTCGTACGTGTACCCGTTCCTCATCCGTACCAACAAGGACAAGGGCATGCCGCTGACTGTGATGCTCTC
TGGAGACTTCTACAATATGATCAACGCTTACGTCAACGCTCGGTATTTGAGTCAGTTTGGCGACTACAGGCACAACGAGGATGAAATGCTTGCTCGGCCT
TCGTTCTACGCCGGAATCGCTCTCTTCGTCTTCGGTTTGTCGATGAACATTTATTCGGATCAGGTGCTGATCAACCTGCGCAAATCTGGCGAGTCGGGCT
ACAAGATCCCCCACGGCGGTTTGTTTGAGTACGTGTCGTCGCCTAACTACCTGAGCGAACTGCTGGAATGGGCGGGCTGGGCAATGTTGACTCAGTCGCC
TGCGGGGCTTTCCTTCGTGGTGTACACCGCTACAAACCTTGTGCCGCGGGCGCTGAGCAACCACAGATGGTATCAAGACAAGTTTCGCGAGGAGTACCCA
GCAAGTCGCCGAGCGATCATCCCCTTTCTGTGGTA