Description :
From Genome Similarity Track
Location :
Scaffold_29:78302- 80736
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_29-snap-gene-0.51Hypoxia-inducible factor 1 alpha inhibitor
Pytve_DAOMBR484snap_masked-pve_contig_29-abinit-gene-0.70Conserved gene of unknown function

Sequence
2434 bases(100 bases per row)
GCACATTTTGCGCTGAAATTGCTCTCGCTTGGCCACTAAACTCAACTTGATCGATTCTTCCTCGTCCCCCAAGGCACTGAATATGGTCGATTGAAACTCC
GCGTCGTCCACCGTCTGATCCCAGCATGCTGCGAGGATAGCAGCTAGCTCCATGCTGGAATCACGAAGCAACGCGCGCCATTCCGCTTGATGTTCCTTGG
CGAGAACTGTCTGGAATGCGCGCAACGTCGTCAGAGGCTCCAACGACAGCACCATCTTCTCTCGCTCTTCTCGATTGTGTGTGTCACAGAATATCCGTAC
GATCTCGTCAATCACATCTAACGGGAGGCTGGCACATTGAGGGCTAGCTTGGCTCGCCGAACGCAGATCCTCGATGAATGTGTCAGTCTGCTGCTTGATC
AGCTCCTCCATCATAACACGCGCATAGTACGCGGTCATCCCTGGATCTTTGGTCAGCTGGACGCGCGTGCCCTCCCACCAGTAGTTGGCAGCGATCGTGT
AGGCATCCGAGTCGACTTGGTGCCACCACCCCTCCGGGATGAACAGTGCATCTGCGAGAACACCACCAGCACACTCAACATCACGGACAAGCAATATACG
AGCTATAGCAGATGAGTACCTCCAGCGCCGACGACAAAGCGCTGAGCTTTCGCCTGCGCAAACTTCGGATGGCGAGTCATGTCCGGATGGTCCACGCTCA
CGTTGCTGTGGTTGGCCGACTTCAAGTGCACGGGAAACGGATACAGGTGGGCGGTCTCGGACGGCGGGTACATCGTCACCACTTTCTGCCCGAACAGCAC
AACCAGCACGTTCTGGTACGCATCGTAGTGCAAGCCTGTCCGTCCCGCGCGCGTGCTCATCCACAGGTTGACTTGACTGAGCGGTTGGTCGCGAAGACAC
TCTGGACTGCATCATTCGTCCACATTAGCTCTCGTAACGACTCGTCATGTAGAGCCAAAGCTATTCAGCACGACGCACATCACAAAGTCGTCCATGACGG
AGGGCAAGGTCGGGGCCGAGCACGTCGCGTCGGGCTTGAACACCGCCACGGGACACTGGCACAAGTAAAAGTCGAGGTCGTCGACGTCCAACAGCCAATG
CGGCCGCCCAGCGAAAGAAGCCTGGTAAAAGTCCACAAAGTCGCCGAACTTGAGCTCGATGGTCTGCCGAGCCTTGTCGTCGCCCGCGTAGCTCTCGACC
GGTCGTTCCTTGCAGGCGATGTCGACCACTGCAACGAAGATTCAGAAGCATCCATGCTTGTCAGTCGTCGACGAAGATCCGGCGAACGCTATTTCGAACC
CGCACCCGTGTTTCGGTGGGCCAAAAATGACGACAAGAGGTGGATTCGGTCCGGCAGGAACTGGGCGAGCGAGGCCGGCCGCACGCAGCGCGCGGCGAAC
CCGAGCATCACCTCGGGCTCATTGCTCGTTTTTCGGTTCATCCTGCATTCATGATAGAGGAATCGTACCTTCAGGGTACACAGTTATATAACTTATTTAC
AACAGTCGCAGGCATTTGAAATAGATTTTTGTGTTGTTTATTTGATTATGCTGTAAAACGCTTTGAAAGCATCTTGCCATCGTACACATGTCGCAGGATC
GCGGAGCTGGATGCCGCCTCCTCGTCATGGGCTCCAGTAAACCATGCGCACACCCCGCAGCAGCTACGCGCACCGCAACGCAGAACCCCATTCAAGGCCG
TTCGTTGCATGCACCGCCTTGCAATCCCTGTCTGGTCCTTCACACTTGCTCCGTCTGCGGCGAGCTCGAGCCCGGCGGACTCGCCGACTCGGCAGCCGCC
TTGGCGTGCCGCACACAGTAGCCGTGGCGTTGAGCCCACTTGAGGCAGTCAGGCTCGGCGCACCGCGATCCACCGCCATGTGCACGGCAGTGACCCTTCG
AGATGGCGCCTTTGTCACAGCCAGGCGCCTGGCAGCGCACGCCGCCGCCGTGGGTCTTGCAGCACCCGCGAGACTGCACGGCGCGCTGGCAGCCGTCCAC
GCGGCAGTACTTGATGCCGCCGTGCGCGCTGCACTTGTGCCCGAACTGCGCGACCCGCTCGCAGCCGTCCTCCGAACACAGCCGCCGCCCGCCGTGGCCC
GAGCATGCGTTGTTGAAGCGCGCAAACTTGGTGCAGCCGGAGACCTCGCACCGCCGCCGGCGGTACCGCTTCGCGCTCTGGNNNNNNNNNNNNNNNCCGG
CTCTGGCGCCGCGCTCTCGCCTCCCATTGCCGGTCTCTTGCGCTCTGGCGACGCGGCCTCGGGCTCAGCAGTTGCAGGCGCCGCCTCCTTTGCAGCGTCG
GCGGCGACAGCGACTGCTGCTGGCTCGCCGCTAGCGGTCGTGGCACCGCCAGCGGCGCTCTGCGGCTGATGCTTGCCCTTGGCGATCACGGCGGCCTCCA
GCAGCGTGTCGATCCACTCCCGCACTGGGTGGCC